Transcript asmbl_379531

Sequence
Transcript Sequence for observation asmbl_379531 of TGE0002736:
GAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTCCTGACTCACCGCTGTTCGCTCTCGCCGAGGAACAAGTCGGTCAGGAAGCCCGCGCGCAACAGCCATGGCTTTTAAGGATACCGGAAAAACACCCGTGGAGCCGGAGGTGGCAATTCACCGAATTCGAATCACCCTAACAAGCCGCAACGTAAAATCCTTGGAAAAGGTGTGTGCTGACTTGATAAGAGGCGCAAAAGAAAAGAATCTCAAAGTGAAAGGACCAGTTCGAATGCCTACCAAGACTTTGAGAATCACTACAAGAAAAACTCCTTGTGGTGAAGGTTCTAAGACGTGGGATCGTTTCCAGATGAGAATTCACAAGCGACTCATTGACTTGCACAGTCCTTCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCAGGAGTTGAGGTGGAAGTCACCATTGCAGATGCTTAAGTCAACTATTTTAATAAATTGATGACCAGTTGTT