Transcript asmbl_50223

Sequence
Transcript Sequence for observation asmbl_50223 of TGE0006023:
GGGAAGTGCAGCCAAGAACCCCTGTGCAGTGTGGAGGTCGTAGGAGTCACTTACTCACCGCCAGGTCCTTCGCTTGCTGGTCCGCGCCCCGCCCGCCGCAGCCATGCTCTCAGCCCTTGCCCGGCCTTCCGGCGCCGCTCTCCGCCGCAGCTTCAGCACCTCGGCCCAGAACAATGCTAAGGTAGCCGTGCTCGGGGCTTCTGGAGGAATTGGGCAGCCCCTTTCACTTCTCCTGAAGAACAGTCCTTTGGTGAGCCGCCTGACCCTCTACGATATTGCTCATACGCCTGGAGTGGCGGCGGATCTGAGCCACATCGAGACCAGAGCAAATGTGAAAGGCTACCTCGGACCTGAGCAGCTGCCCGAATGCCTGAAAGGTTGTGATTTGGTGGTTATTCCAGCCGGAGTCCCAAGAAAACCAGGCATGACACGGGATGACCTGTTCAACACCAATGCCACAATTGTGGCCACCTTGACTGCTGCGTGTGCTCAACATTGCCCTGACGCCATGATCTGTGTCATTGCAAATCCGGTCAACTCCACCATCCCAATCACGTCAGAAGTTTTCAAGAAACATGGAGTATACAACCCCAGTAAAATCTTTGGGGTGACGACCCTGGATATTGTCAGAGCCAACACTTTTGTTGCAGAACTGAAGGGTTTGGATCCAGCTCGAGTCAATGTCCCTGTCATTGGCGGCCATGCTGGGAAGACCATCATCCCCCTGATCTCTCAGTGCACTCCCAAGGTGGACTTTCCCCAGGACCAGCTGACAGCGCTTACTGGGCGGATCCAGGAGGCTGGCACGGAGGTGGTCAAGGCTAAAGCTGGAGCAGGCTCTGCCACCCTGTCCATGGCATATGCCGGAGCCCGGTTTGTCTTTTCCCTTGTGGATGCAATCAACGGAAAGGAAGGAGTGGTTGAATGTTCTTTTGTTAAATCCCAAGAAACGGACTGTCCCTATTTCTCCACACCATTGCTGCTTGGAAAAAAGGGCATCGAGAAAAATCTAGGCATTGGCAAAGTTTCCCCTTTTGAAGAGAAGATGATAGCTGATGCCATTCCTGAGCTGAAAGCCTCAATCAAGAAAGGAGAAGAGTTTGTGAAGAACATGAAATGAGAAAACTGTTAGCAGGCAGTCCATTTCCTTAACTTATTAAGGCATTCTGTCACTGTAAAGCATTTCAGATTTCTTTGTATTTCATTTTGCTTTAACGATGAATATTGTATTAATGTTACCATCCCTTCCTAGTTGCGGATCAGTCTATTGGTGCATCAATAAAAGTAGGCTTTGATTTTCTTTTTCAAGGTCTCTGCCATAAATATTGTGCTTTCTTCCCTACTAGAGCTGACTTGAGTGTCTG