Transcript asmbl_28093

Sequence
Transcript Sequence for observation asmbl_28093 of TGE0001085:
CGAGGGGGCGGGACATGCCGGCAGTCTCGCGATAACTGCGCAGGCGCGGACCAAAGCGATCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCGCAAGTTCACCTACCGCGGCGTGGACCTCGACCAGCTGCTGGACATGTCCTACGAGCAGCTGATGCAGCTGTACAGTGCGCGCCAGCGGCGGCGGCTGAACCGGGGCCTGCGGCGGAAGCAGCACTCCCTGCTGAAGCGCCTGCGCAAGGCCAAGAAGGAGGCGCCGCCCATGGAGAAGCCGGAAGTGGTGAAGACGCACCTGCGGGACATGATCATCCTACCCGAGATGGTGGGCAGCATGGTGGGCGTCTACAACGGCAAGACCTTCAACCAGGTGGAGATCAAGCCCGAGATGATCGGCCACTACCTGGGCGAGTTCTCCATCACCTACAAGCCCGTAAAGCATGGCCGGCCCGGCATCGGGGCCACCCACTCCTCCCGCTTCATCCCTCTCAAGTAATGGCTCAGCTAATAAAGGCGCACATGACTCC