Transcript asmbl_35938

Sequence
Transcript Sequence for observation asmbl_35938 of TGE0056385:
GGAGGATCCACTCCCTGCCGCGGCTCTCCCTCCAGTGGACTGCCTTCCCGCCTGCCTGGCGGTGGGAGGGCGCGGCAGAGGGACGTCACATCCGGGCGGGTTGGTGAGTTCCGGTATTTCAGGGCGTAGCAGGCGGAAGTAAGGGTGAGAGGAGGCTGCAACGCCGAGCGGAGGAGGCAGGAACCGGAGCGCGAGCAGTAGCTGGGTGGGCACCATGGCTGGGATCACCACCATCGAGGCGGTGAAGCGCAAGATCCAGGTTCTGCAGCAGCAGGCAGATGATGCAGAGGAGCGAGCTGAGCGCCTCCAGCGAGAAGTTGAGGGAGAAAGGCGGGCCCGGGAACAGGCTGAGGCTGAGGTGGCCTCCTTGAACCGTAGGATCCAGCTGGTTGAAGAAGAGCTGGACCGTGCTCAGGAGCGCCTGGCCACTGCCCTGCAAAAGCTGGAAGAAGCTGAAAAAGCTGCTGATGAGAGTGAGAGAGGTATGAAGGTTATTGAAAACCGGGCCTTAAAAGATGAAGAAAAGATGGAACTCCAGGAAATCCAACTCAAAGAAGCTAAGCACATTGCAGAAGAGGCAGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGATCATTGAAGGAGACTTGGAACGCACAGAGGAACGAGCTGAGCTGGCAGAGTCCCGTTGCCGAGAGATGGATGAGCAGATTAGACTGATGGACCAGAACCTGAAGTGTCTGAGTGCTGCTGAAGAAAAGTACTCTCAAAAAGAAGATAAATATGAGGAAGAAATCAAGATTCTTACTGATAAACTCAAGGAGGCAGAGACCCGTGCTGAGTTTGCTGAGAGATCGGTAGCCAAGCTGGAAAAGACAATTGATGACCTGGAAGATAAACTGAAATGCACCAAAGAGGAGCACCTCTGTACACAAAGGATGCTGGACCAGACCCTGCTTGACCTGAATGAGATGTAGAACGCCCCAGTCCCACCCTGCTGCTGCTCCTCCCTCTGACCCAGACTCCGCCTGAGGCCAGCCTGCGGGAAGCTGACCTTTAACTGAGGGCTGATCTTTAACTGGAAGGCTGCTTTCTCCTTTCACCACCCCCTCCTTCCCTGTGTCTTTTTCGCCAAACTGTCTCTGCCTCTTCCCGGAGAATCCAGCTGGGCTAGAGGCTGAGCACCTTTGGAAACAACATTTAAGGGAATGTGAGCACAATGCATAATGTCTTTAAAAAGCATGTTGTGATGTACACATTTTGTAATTACCTTTTTTGTTGTTTTGTAGCAACCATTTGTAAAACATTCCAAATAATTCCACAGTCCTGAAGCAGCAATCGAATCCCTTTCTCACTTTTGGAAGGTGACTTTTCACCTTAATGCATATTCCCCTCTCCATAGAGGAGAGGAAAAGGTGTAGGCCTGCCTTACCGAGAGCCAAACAGAGCCCAGGGAGACTCCGCTGTGGGAAACCTCATTGTTCTGTACAAAGTACTAGCTAAACCAGAAAGGTGATTCCAGGAGGAGTTAGCCAAACAACAACAAAAACAAAAAATGTGCTGTTCAAGTTTTCAGCTTTAAGATATCTTTGGATAATGTTATTTCTATTTTTTATTTTTTTCATTAGAAGTTACCAAATTAAGATGGTAAGACCTCTGAGACCAAAATTTTGTCCCATCTCTACCCCCTCACAACTGCTTACAGAATGGATCATGTCCCCCTTATGTTGAGGTGACCACTTAATTGCTTTCCTGCCTCCTTGAAAGAAAGAAAGAAAGAAGACTGTGTTTTTGCCACTGATTTAGCCATGTGAAACTCATCTCATTACCCTTTTCTGGGTTTGAAGCTGCTGTCTCTAGAAGTGCCATCTCAATTGTGCTTTGTATCAGTCAGTGCTGGAGAAATCTTGAATAGCTTATGTACAAAACTTTTTAAATTTTATATTATTTTGAAACTTTGCTTTGGGTTTGTGGCACCCTGGCCACCCCATCTGGCTGTGACAGCCTCTGCAGTCCGTGGGCTGGCAGTTTGTTGATCTTTTAAGTTTCCTTCCCTACCCAGTCCCCATTTTCTGGTAAGGTTTCTAGGAGGTCTGTTAGGTGTACATCCTGCAGCTTATTGGCTTAAAATGTACTCTCCTTTTATGTGGTCTCTTTGGGGCCGATTGGGAGAAAGAGAAATCAATAGTGCAACTGTTTTGATACTGAATATTGACAAGTGTCTTTTTGAAATAAAGAACCAGTCCCTCCAA