Transcript asmbl_358141

Sequence
Transcript Sequence for observation asmbl_358141 of TGE0002528:
CGTGGGCGGTGCCACCCCTCCCCCCGGCGGCCCCGCGCGCAGCTCCCGGCTCCCTCCCCCTTCGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGGAGGCGGTGAAGTCGGTGGCTTTCCTTCTCTCTAGCTCTCGCTCGCTGGTGGTGCTTCAGATGCCACACGCGTCCCGGGGGCCCGGTTCTCCGCTCCCCTCCCCTCCCCTTCTCGCCGGACCCCGCGCCGGGAGCTGCGGGAAGGAGTGGAGGGTCGGGCGGTGGCCTCGCGGCTGGCCTGGCGCGCGGCCAGCGCCGGTAGTTAGTGGGGGGACTGCTCTGCCCTCGAGGGGGTAGGGAGCTGTGGCGACGGTTGCCCCATTTCGAGACAAAGCGCATTTCCCCCTCCCCTCCCCCACCCGCGTTCCGGCGGAGGCGCCCCCTCCCCCAGCCGCCACGCGGGGCTGGGTCGAGACTTGGGCCTCCCGGAGGGCGGCGCGTGGTCCCGCGTCCGCGAGGCCTGGCGGCGCGCGGCCGGCTGTCCCGAGGCTGCGGCGACCGCCCAGTTAACGTGGCCGCCGCGGGGGTAGGCGCGTGCGGTGTGGCGCAGTGCCCTTGAGCCCCCGTGCCGCGGCCTTTGTTTCTCCCCGCGGATGCGCTGACCACGAGGCCCGCGCTCCCGGGTGGGGGCGGGCACCCGCGCTTAGGCCTCTGGACGCCGGGCTTCAGCGGCGGGGGTCGGGAGCGGGTGTTTGCAAGAGGTGATTCTTTTTTCAAAGTGTCACGAAACGGGGTTGAAGCATCTTAAGTTTTTTCCTTTTGTTATTTAATTACCGATTGGAAAGAGGGAGGGTTTCTGAGCAGAAACCAAGTTGGGATTGCAGAACAGAGAAGATTCACAGTGCTTTACCGTTGTGAGTTGTTTGGGTAATCGTGCCTGGTTTTAAACCGAAAGGATTGTCCTTTAAAAATGGAACATGGACTTTATTATAAATGGGACTTAGATTGGAAAAGACATTGGTCCCCTATTTTAAGCCATGTGAAGCTGTTTTAGGTACCAGGATCCCCAGTAAAGTCTTTCTAGACTCACATGGTTAGGACACGTACTTAAGTACATCATAAGCAATGTAGGTAGGAGCGCAGATCTACTCTGGATTTGTATTCACGTTTGAAATGTGCGCTCTCTACTTGGGGGTTGGAATCCAAACAGAATTTGTATTTAGTTACCTTTTTTGTGTCATGCAAACTTACCTTAACTGTCATGCATTTTTCTAGTAATAGCTCTTCAAGTCTGCAATAAAAAATGGCCTCCAACAAAACTACATTGCAAAAAATGGGAAAAAAACAGAATGGAAAGAGTAAAAAAGTTGAAGAGGCAGAGCCTGAAGAATTTGTCGTGGAAAAAGTACTAGATCGACGTGTAGTGAATGGGAAAGTGGAATATTTCCTGAAGTGGAAGGGATTTACAGATGCTGACAATACTTGGGAACCTGAAGAAAATTTAGATTGTCCAGAATTGATTGAAGCGTTTCTTAACTCTCAGAAAGCTGGCAAAGAAAAAGATGGTACAAAAAGAAAATCTTTATCTGACAGTGAATCTGATGACAGCAAATCAAAGAAGAAAAGAGATGCTGCTGACAAACCAAGAGGATTTGCCAGAGGTCTTGATCCTGAAAGAATAATTGGTGCCACAGACAGCAGTGGAGAATTGATGTTTCTCATGAAATGGAAAGATTCAGATGAGGCAGACTTGGTGCTGGCGAAAGAGGCAAATATGAAGTGTCCTCAAATTGTAATTGCTTTTTATGAAGAGAGACTAACTTGGCATTCTTGTCCAGAAGATGAAGCTCAATAATTGTTCACATTGTTCTTTTATATATATTTATATATATATATAAAAATTGGGTCTTAGATTTTGATTTACTAGTGTGACAAAATAACTACATCCTAATGAAAATCAAGTTTGATATGTTTGTTTTGAAAGTAGCGTTGGAAGAGTTGTTGGGGGTTTTTTGCATCCATAGCACTGGTTACTTTGAACAAATAAATAAAAGCTTTCTGTAGTTGCTTCCTTTATCAGAAAAGAACATTTGATACCATGGTATATCATTTCCTCTTCATTAAAGAACAGCTTTTCTAAATGTTGGGGGAAATGTCCATAGTCATTACTCAGTCAAAACTTGTGTTCTCATGAGCCTAAGGACCATTCTAGATTTATTACGTGTTTTTTGTGTGTGTGTGTGTGTGTGTGT