Transcript asmbl_358140

Sequence
Transcript Sequence for observation asmbl_358140 of TGE0002528:
CGTGGGCGGTGCCACCCCTCCCCCCGGCGGCCCCGCGCGCAGCTCCCGGCTCCCTCCCCCTTCGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGGAGGCGGTGAAGTCGGTGGCTTTCCTTCTCTCTAGCTCTCGCTCGCTGGTGGTGCTTCAGATGCCACACGCGTCCCGGGGGCCCGGTTCTCCGCTCCCCTCCCCTCCCCTTCTCGCCGGACCCCGCGCCGGGAGCTGCGGGAAGGAGTGGAGGGTCGGGCGGTGGCCTCGCGGCTGGCCTGGCGCGCGGCCAGCGCCGGTAGTTAGTGGGGGGACTGCTCTGCCCTCGAGGGGGTAGGGAGCTGTGGCGACGGTTGCCCCATTTCGAGACAAAGCGCATTTCCCCCTCCCCTCCCCCACCCGCGTTCCGGCGGAGGCGCCCCCTCCCCCAGCCGCCACGCGGGGCTGGGTCGAGACTTGGGCCTCCCGGAGGGCGGCGCGTGGTCCCGCGTCCGCGAGGCCTGGCGGCGCGCGGCCGGCTGTCCCGAGGCTGCGGCGACCGCCCAGTTAACGTGGCCGCCGCGGGGGTAGGCGCGTGCGGTGTGGCGCAGTGCCCTTGAGCCCCCGTGCCGCGGCCTTTGTTTCTCCCCGCGGATGCGCTGACCACGAGGCCCGCGCTCCCGGGTGGGGGCGGGCACCCGCGCTTAGGCCTCTGGACGCCGGGCTTCAGCGGCGGGGGTCGGGAGCGGGTGTTTGCAAGAGTAATAGCTCTTCAAGTCTGCAATAAAAAATGGCCTCCAACAAAACTACATTGCAAAAAATGGGAAAAAAACAGAATGGAAAGAGTAAAAAAGTTGAAGAGGCAGAGCCTGAAGAATTTGTCGTGGAAAAAGTACTAGATCGACGTGTAGTGAATGGGAAAGTGGAATATTTCCTGAAGTGGAAGGGATTTACAGATGCTGACAATACTTGGGAACCTGAAGAAAATTTAGATTGTCCAGAATTGATTGAAGCGTTTCTTAACTCTCAGAAAGCTGGCAAAGAAAAAGATGGTACAAAAAGAAAATCTTTATCTGACAGTGAATCTGATGACAGCAAATCAAAGAAGAAAAGAGATGCTGCTGACAAACCAAGAGGATTTGCCAGAGGTCTTGATCCTGAAAGAATAATTGGTGCCACAGACAGCAGTGGAGAATTGATGTTTCTCATGAAATGGAAAGATTCAGATGAGGCAGACTTGGTGCTGGCGAAAGAGGCAAATATGAAGTGTCCTCAAATTGTAATTGCTTTTTATGAAGAGAGACTAACTTGGCATTCTTGTCCAGAAGATGAAGCTCAATAATTGTTCACATTGTTCTTTTATATATATTTATATATATATATAAAAATTGGGTCTTAGATTTTGATTTACTAGTGTGACAAAATAACTACATCCTAATGAAAATCAAGTTTGATATGTTTGTTTTGAAAGTAGCGTTGGAAGAGTTGTTGGGGGTTTTTTGCATCCATAGCACTGGTTACTTTGAACAAATAAATAAAAGCTTTCTGTAGTTGCTTCCTTTATCAGAAAAGAACATTTGATACCATGGTATATCATTTCCTCTTCATTAAAGAACAGCTTTTCTAAATGTTGGGGGAAATGTCCATAGTCATTACTCAGTCAAAACTTGTGTTCTCATGAGCCTAAGGACCATTCTAGATTTATTACGTGTTTTTTGTGTGTGTGTGTGTGTGTGTGT