Transcript asmbl_358139

Sequence
Transcript Sequence for observation asmbl_358139 of TGE0002528:
CGTGGGCGGTGCCACCCCTCCCCCCGGCGGCCCCGCGCGCAGCTCCCGGCTCCCTCCCCCTTCGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGGAGGCGGTGAAGTCGGTGGCTTTCCTTCTCTCTAGCTCTCGCTCGCTGGTGGTGCTTCAGATGCCACACGCGTCCCGGGGGCCCGGTTCTCCGCTCCCCTCCCCTCCCCTTCTCGCCGGACCCCGCGCCGGGAGCTGCGGGAAGGAGTGGAGGGTCGGGCGGTGGCCTCGCGGCTGGCCTGGCGCGCGGCCAGCGCCGGTAGTTAGTGGGGGGACTGCTCTGCCCTCGAGGGGGTAGGGAGCTGTGGCGACGGTTGCCCCATTTCGAGACAAAGCGCATTTCCCCCTCCCCTCCCCCACCCGCGTTCCGGCGGAGGCGCCCCCTCCCCCAGCCGCCACGCGGGGCTGGGTCGAGACTTGGGCCTCCCGGAGGGCGGCGCGTGGTCCCGCGTCCGCGAGGCCTGGCGGCGCGCGGCCGGCTGTCCCGAGGCTGCGGCGACCGCCCAGTTAACGTGGCCGCCGCGGGGGTAGGCGCGTGCGGTGTGGCGCAGTGCCCTTGAGCCCCCGTGCCGCGGCCTTTGTTTCTCCCCGCGGATGCGCTGACCACGAGGCCCGCGCTCCCGGGTGGGGGCGGGCACCCGCGCTTAGGCCTCTGGACGCCGGGCTTCAGCGGCGGGGGTCGGGAGCGGGTGTTTGCAAGAGGTGATTCTTTTTTCAAAGTGTCACGAAACGGGGTTGAAGCATCTTAAGTTTTTTCCTTTTGTTATTTAATTACCGATTGGAAAGAGGGAGGGTTTCTGAGCAGAAACCAAGTTGGGATTGCAGAACAGAGAAGATTCACAGTGCTTTACCGTTTAATAGCTCTTCAAGTCTGCAATAAAAAATGGCCTCCAACAAAACTACATTGCAAAAAATGGGAAAAAAACAGAATGGAAAGAGTAAAAAAGTTGAAGAGGCAGAGCCTGAAGAATTTGTCGTGGAAAAAGTACTAGATCGACGTGTAGTGAATGGGAAAGTGGAATATTTCCTGAAGTGGAAGGGATTTACAGATGCTGACAATACTTGGGAACCTGAAGAAAATTTAGATTGTCCAGAATTGATTGAAGCGTTTCTTAACTCTCAGAAAGCTGGCAAAGAAAAAGATGGTACAAAAAGAAAATCTTTATCTGACAGTGAATCTGATGACAGCAAATCAAAGAAGAAAAGAGATGCTGCTGACAAACCAAGAGGATTTGCCAGAGGTCTTGATCCTGAAAGAATAATTGGTGCCACAGACAGCAGTGGAGAATTGATGTTTCTCATGAAATGGAAAGATTCAGATGAGGCAGACTTGGTGCTGGCGAAAGAGGCAAATATGAAGTGTCCTCAAATTGTAATTGCTTTTTATGAAGAGAGACTAACTTGGCATTCTTGTCCAGAAGATGAAGCTCAATAATTGTTCACATTGTTCTTTTATATATATTTATATATATATATAAAAATTGGGTCTTAGATTTTGATTTACTAGTGTGACAAAATAACTACATCCTAATGAAAATCAAGTTTGATATGTTTGTTTTGAAAGTAGCGTTGGAAGAGTTGTTGGGGGTTTTTTGCATCCATAGCACTGGTTACTTTGAACAAATAAATAAAAGCTTTCTGTAGTTGCTTCCTTTATCAGAAAAGAACATTTGATACCATGGTATATCATTTCCTCTTCATTAAAGAACAGCTTTTCTAAATGTTGGGGGAAATGTCCATAGTCATTACTCAGTCAAAACTTGTGTTCTCATGAGCCTAAGGACCATTCTAGATTTATTACGTGTTTTTTGTGTGTGTGTGTGTGTGTGTGT