Transcript asmbl_50070

Sequence
Transcript Sequence for observation asmbl_50070 of TGE0009943:
GCTCGGTGAGCAGAGAAAAGGGGCCACCGGTCGCCCCCCCGCTTCTCCGCACGCGCTCTTTAGCCGTGGCCGCCCGCCTGCCGCGGTTACCTGGGCCTCTCTCACGGTCCCTTCTGATTGGATCTAGACGCTGAGCGAGGCCCTGCTAGGGCGGCCATGCGGCGGTGACAGGAGCTCGGTTGAGACGCACGGGCCCCTCGCCCTCTCACCTCCTGTCCGCTAGCCAGCTCGCCTCACCCCGAGGCTGCTCCACCGCGGCCGCAGCTCGTGCACGGCCCACACTCGCTTCCCTTCGGCACCCCGACCCCAGCGCTGCCTGGAGGCGGCTGCACTCGGGGATCATGGCCCAAGTAGCAATGTCTACCCTGCCAGTAGAAGATGAAGAGTCTTCAGAGAGCAGGATGGTGGTGACATTCCTCATGTCTGCTCTAGAGTCCATGTGTAAAGAACTGGCCAAGTCCAAGGCAGAAGTGGCCTGCATTGCAGTGTATGAAACAGATGTGTTTGTTGTTGGAACTGAGAGAGGACGGGCTTTTGTCAACACCAGAAAGGATTTTCAGAAAGATTTTGTGAAATACTGTGTTGAAGAAGAAGAAAAGGCGGCAGAGATGCATAAAATGAAATCTACAACCCAGGCAAATCGGATGAGTGTAGATGCTGTAGAGATTGAAACACTCAGAAAAACAGTTGAGGACTATTTCTGCTTTTGCTATGGGAAAGCTTTAGGCAAATCAACAGTGGTGCCTGTTCCCTATGAGAAGATGCTACGAGATCAGTCTGCTGTGGTAGTGCAGGGGCTTCCAGAAGGAGTTGCCTTTAAACACCCTGAGAACTATGATCTTGCAACTCTGAAATGGATTTTGGAGAACAAAGCAGGGATTTCATTTATCATTAAGAGACCTTTCCTGGAGCCAAAGAAGCACCTAGGTGCTCGCGTGATGGTAACAGATGCTGAAAGGTCAATGCTATCTTCAGGTGGAAGTTGTGGCCCCATCAAAGTGAAAACTGAACCCACAGAAGATTCTGGTATTTCCTTGGAAATGGCAGCTGTGACAGTAAAGGAAGAATCAGAAGATCCTGATTACTATCAATATAACATTCAAGGAAGCCATCATTCTTCAGAGGGCAATGATGGAACAGAAATGGAAGTACCAGCAGAAGATTCTACTCAACATGTCCCTTCAGAAACAAGTGAGGACCCCGAAGTTGAGGTGACTATTGAAGATGATGATTATTCTCCACCTACTAAGAGACCAAAGAGCAATGAGCCACCCCAGCCACCAGTCACAGAACCCGCCAATGCCGGAAAACGGAAAGTGAGAGAGTTCAACTTTGAGAAATGGAATGCTCGAATTACTGATCTGCGTAAACAAGTCGAAGAGTTGTTTGAAAGAAAATATGCTCAAGCTATAAAAGCCAAAGGTCCTGTGACGATCCCATACCCTCTTTTCCAGTCACATGTTGAAGATCTATATGTGGAAGGACTTCCAGAAGGAATTCCTTTTAGAAGGCCATCTACTTATGGAATTCCTCGCCTTGAGAGAATATTACTTGCAAAGGAAAGGATTCGTTTTGTGATTAAGAAACACGAACTTCTGAATTCAACACGCGAAGACCTACAACTTGATAAACCAGCTTCAGGAGTAAAGGAAGAGTGGTATGCCAGAATCACTAAATTACGAAAGATGGTAGATCAGCTTTTCTGCAAAAAATTTGCTGAAGCCTTGGGGAGTACTGAAGCCAAGGCTGTACCTTACCAGAAGTTCGAGGCACATCCTAATGATCTCTATGTGGAAGGACTTCCAGAAAATATTCCTTTTAGAAGTCCCTCGTGGTATGGAATCCCAAGGCTTGAAAAAATCATTCAAGTGGGCAATCGAATTAAATTTGTTATTAAAAGACCAGAACTTCTGACTCACAGTACTACTGAAGTTACTCAGCCAAGAACGAATACACCAGTCAAAGAAGATTGGAATGTCAGAATTACTAAACTACGAAAGCAAGTGGAAGAGATTTTTAATTTGAAATTTGCTCAAGCTCTTGGACTCACAGAGGCAGTAAAAGTACCATATCCTGTGTTTGAATCAAATCCTGAGTTCCTTTACGTAGAAGGCTTGCCAGAAGGAATTCCCTTTCGAAGTCCTACCTGGTTTGGAATTCCACGACTTGAAAGGATTGTCCGTGGCAGTAATAAAATCAAGTTTGTTGTCAAAAACCTTGCAGTCCCCGAAAAGACCACGAAGCCCTGGGAGTAATTCAAAAGTTCCTGAAATTGAGGTCACTGTGGAAGGCCCTAATAACAACAACCCTCAGACCTCAGCTGTGCGAACCCCTACCCAGACTAATGGTTCTAATGTTCCTTTTAAGCCTCGAGGGAGAGAGTTTTCCTTTGAGGCATGGAATGCCAAAATCACAGACCTAAAACAAAAAGTTGAAAATCTTTTCAATGAAAAATGTGGTGAAGCTCTCGGCCTTAAACAAGCTGTGAAAGTGCCATTTGCATTATTTGAGTCTTTCCCAGAAGACTTTTATGTAGAAGGCTTACCGGAGGGTGTGCCATTTCGTCGACCATCTACTTTTGGCATTCCAAGGCTGGAGAAGATACTCAGAAACAAAGCCAAAATTAAGTTCATTATTAAAAAGCCCGAAATGTTTGAGACAGCAATTAAGGAGAGCACCTCCTCCTCTAAGAGCCCTCCAAGAAAAATAAATTCGTCGCCCAATGTTAATACTACTGCATCAGGTGTTGAAGATCTTAACATCATTCAGGTGACAATTCCAGACGATGATAATGAAAGACTGTCTAAAGTTGAAAAAGCTAGACAGCTAAGAGAACAAGTTAATGACCTCTTCAGTCGAAAATTCGGTGAAGCTATTGGTATGGGTTTCCCTGTGAAAGTTCCCTACAGGAAAATCACAATTAACCCTGGCTGTGTGGTAGTTGATGGCATGCCTCCTGGAGTGTCATTCAAAGCTCCCAGCTACCTGGAAATCAGTTCCATGAGAAGGATTTTAGATTCTGCTGAGTTCATTAAGTTCACAGTCATTAGACCATTTCCAGGACTTGTGATTAATAACCAGTTGGTTGATCAGAATGAGTCAGAAAGCCCAGTGATCCAAGAATCAGCTGAACCAAGCCAGTTGGAGGTTCCTGCAACAGAAGAAATAAAGGAGTCTGATGGAAGCTCTCAGATCAAGCAAGAACCAGACCCTACGTGGTAGACCTCTTCCCTCCTAGGCTTAAAGTATCAGTGGGTGAGAAGAGCTTTTCGGACCTGTTACTGCCCCAAGCTGTGTAATATACTTGTATAACAGAAATACCTTCTATACAAACCTTTTTTTCTACTTTTAGATAGAAATGTCTACTTTTTCAGCAGTTCTGTGAATTGAATTAAAGAGCAGAGTGACTGTAGATTTGGAATGGCTGGTTTACTTTGGAATGTATTATAAGGATTTTACAGCAATGCTGGAAAAACGACAGGGAAAATGACAGGGATGAATCTCACCAGATTTTTTTTATGGATTCAGCAGAGCCTTCAGCTATGGTGTTTATTTTCCAATCAAGTGAAGATATCTCTTACTGGAACATCTCAGCTTCTGCAGTGAAGAAAACACCTGTGATAGTTTAGTTCTTTAGTTTTTCTATTTGAAAAATCATTTAAATGATCCTTTTGTTCACGGCTCTCCTTAATGACTGAGTGAACAGTTAGTATCTGTATATTTGACTAAACCTTTTCCTAAGCTATCTATCATGGTTCATACGTTTTTTATCATAATTAAAAAACAACCATCTGGATTATCTAATAGCCGGTAAGAGGTCAGTATCTCAGTGTGTGGCTTATAGATGGAATACAGAGAACCTCTTCCACATTTACTTTTCATCCAAATAAAATGCATGGTGTACCAGAAGTTTAAGATCAGGTATGACTGTTTGGGCAAGCTAAATGACACTAAAGCCTCACTATCATGTAACCTGTTGTGGTGTGGATTTCTTTGGAACACTGTTCCAGCTTGAATCAATCTCAAGGGGTTTTCATTGCCGTCATTATTTTATAATTCTACTTGTAAAATTGAGGCTCCAGTGTGGGGAATGAAGGGTCATAAGCTAATTATGCACCCACTGATATTCTGCGCCATTTGTAGGAGAATCTTACACATGTTGAGATTTCACAGACAATAAGAGTTGTAAAATCCAAGCTATATGAAAAGCTAGAGTATGTGATGGCATAGAGTGTTCATTAGCTTTATCACAATATTCACAATGGAGAATTATATTACATGGTAGCAGGGATAGGCATTTTTATGTGTTGCTTATATTTTACCTCAAATTAAAATGTAGATATAGGGTAATA