Transcript asmbl_50034

Sequence
Transcript Sequence for observation asmbl_50034 of TGE0006011:
GCCGGACCCGCCTCCCGTCTTCCTCTCTCTACCTCAGCAGAAGCCGCCGGGGTCTTCTTGGAGTCTAACTGTTGTAGACGCCCACCCGCTGTGCAGTTGCGATGCCGCGTGGTAGCCGAAGCCGCACCTCCCGCATGGCCCCGCCGTCCAGCCGGGCACCTCAGATGAGAGCTGCGCCCAGACCAGCGCCAGCAGCCCAGCTGCCAGCAGCAGCTCCACCATCTGCTGTTGGCTCACCTGCTGCTGCACCCCGGCAGCCAGGTCTGATGGCCCAGATGGCAACTACTGCAGCTGGTGTAGCTGTGGGCTCTGCTGTTGGCCACACGCTAGGTCATGCCATCACTGGGGGCTTCGGTGGAAGTAACACTGAGCCCTCAAGGCCTGACATCACTTACCAGGAGCCACAGGGAACCCAGCCGGCATACCAGCAGCAGCAGCAGTTTGGCCCATGCCACTATGAGATGAAACAGTTTTTGGAGTGTGCCCAGAACCAGGGTGACCTTAAGCTTTGTGAGGGTTTCAGCGAGGTGCTGAAACAGTGCAGATTTGCAAATGGATTAGCCTAATCAAGAAGTTCAAATTGAAGACATGGAAAATCATCTCTCACGACCAAGTTAATTTAGTATAAAAATATAATGGATAGTGAAAGTATAAAGTGTAAAACCACCAGTTAAACCTCTCTATTATTAATAGCTTCCTTGCCTCAGAATTGCAGTGGAAGAGAGTGTTCATACTGTATAGTTCATTGAGATGGTATTGAGTTTGGGGTTGGGCAGATGGTTTTGTGGGCTCCTTAAACCAGGTTTTGTGATGTTATTTGTGAATCGATTAGAATAAAGTGATTTTCTTCC