Transcript asmbl_355121

Sequence
Transcript Sequence for observation asmbl_355121 of TGE0005318:
AGCGTCTAGTCTATTTATTGTCGCGGGGAAGCTGCGGCCGCCTCGCACCCGGAACAACAAAGCAAGGAAGACGGAGTCCGAGCCTCGGGGGCTCCTAGCAACGGGCCGGGGCGGGAGTTCCATGGAGACTGGGGAGCGCGCCCGTCTCATCCTCATCCTTGTCCTCCAGCTTCTCCTTCGCATCCGACGCAACCGGCAGCAGCGCTGCCGCCGCGTCCTCAGCCACCGCTCCCTCTTCCCACGGATGTGATCTTCGTGGTGGAAAGCTAAATTTTAAAACCACCCCAATGGATGCAGACAGTGATGTTGCATTGGACATTCTAATTACAAATGTAGTCTGTGTTTTTAGAACAAGATGTCATTTAAACTTAAGGAAGATTGCTTTGGAAGGAGCAAATGTAATTTATAAACGTGATGTTGGAAAAGTATTAATGAAGCTTAGAAAACCTAGAATTACAGCTACAATTTGGTCCTCAGGAAAAATTATTTGCACTGGAGCAACAAGTGAAGAAGAAGCTAAATTTGGTGCCAGACGCTTAGCCCGTAGTCTGCAGAAACTAGGTTTTCAGGTAATATTTACAGATTTTAAGGTTGTTAACGTTCTGGCAGTGTGTAACATGCCATTTGAAATCCGTTTGCCAGAATTCACAAAGAACAATAGACCTCATGCCAGTTACGAACCTGAACTTCATCCTGCTGTGTGCTATCGGATAAAATCTCTAAGAGCTACATTACAGATTTTTTCAACAGGAAGTATCACAGTAACAGGGCCCAATGTAAAGGCTGTTGCTACTGCTGTGGAACAGATTTACCCATTTGTGTTTGAAAGCAGGAAAGAAATTTTATAATTCACCACTTAATTGGTTAGAATCTCTAACTGAGCACCTTTTAAACCTGCTGCACATTGGACTCAAAAGGAAAACTGGACCAACAATAATTGAGGAAATAGACTCTTTTATTCATTCACGGCTACAGTGTAAGCTCCAGTCCCTTTGGATTTTATTCCAAACCTTGCTGTAATATAAAAGGAAGTTTACAAGACATGATATTGCTGCTTTTACAAAAGGACATTCTATTTATTTTCGCAGTAATTCTCATGTCCCCATAAGCAGAGCTGTCACAGTGTGCACTACCTTAGATTGTTTTATTGTCGTCATTGTTATTTTTTTCCATTTTGAGCTAATGTGTTTTATTTGTGAATAGTCTTTTACATTTTTGTATGCTGAATATGGGCACCAAAGAACCTGTAAAAGTTATCTTTTTCAATTGAATGTGCACAAATAAAAGTTTGGAAAAGATCTCTCTTCATTCTATAACTTTTATTCCCCATTTTCTATTTTAACAAAAATTGTATTCATACTTCTTTTTTTTAAAATCTATGCAAGCTTAAGACTTTGGCTAAAGTGTGTTGGCTTCTTTTTGAAGTGTA