Transcript asmbl_354252

Sequence
Transcript Sequence for observation asmbl_354252 of TGE0002448:
TGACTACCGAAGCTCGAGCCCCGAACCCAGCCGCTTCCCTAGGGGTCCAGCAGCAGCGGGCGCGAATCGGCACATTACCGGGGGACCGCGGGGCGCTCAGGACTGCGACAACTCTGTGGGTTACCGCGCCGGCCTAGCGGCCCAGCGACGCCCCCCAGCGGCCAGAGAAGGCCGCGCTTCTCGGGGTTGGCCCACCCAACCGCTCTGCGGGTAGGACCGAGGAGCAAAGCATTATCGCGAGATCAGGGCCACTATTTGAGCGCATGCGCAAGACATGCTAGTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCCTGTACGAGGCGGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGCAAGTTCCTGGAGACGGTGGAGTTGCAGATCAGCTTGAAGAACTATGATCCCCAGAAGGACAAGCGCTTCTCGGGCACCGTCAGGCTTAAGTCCACTCCCCGCCCTAAGTTCTCTGTGTGTGTCCTGGGGGACCAGCAGCACTGTGACGAGGCTAAGGCCGTGGATATCCCCCACATGGACATCGAGGCGCTGAAAAAACTCAACAAGAATAAAAAACTGGTCAAGAAGCTGGCCAAGAAGTATGATGCGTTTTTGGCCTCAGAGTCTCTGATCAAGCAGATTCCACGAATCCTCGGCCCAGGTTTAAATAAGGCAGGAAAGTTCCCTTCCCTGCTCACACACAACGAAAACATGGTGGCCAAAGTGGATGAGGTGAAGTCCACAATCAAGTTCCAAATGAAGAAGGTGTTATGTCTGGCTGTAGCTGTTGGTCACGTGAAGATGACAGACGATGAGCTTGTGTATAACATTCACCTGGCTGTCAACTTCTTGGTGTCATTGCTCAAGAAAAACTGGCAGAATGTCCGGGCCTTATATATCAAGAGCACCATGGGCAAGCCCCAGCGCCTATATTAAGGCACATTTGAATAAA