Transcript asmbl_28063

Sequence
Transcript Sequence for observation asmbl_28063 of TGE0001081:
GGGCAGCGCGCGCGGGGGACGTGTGCGGGCGTCTCCGCCATTTTGTGAGTCTATAACTCGGAGCCGTTGGGTCGGTTCCTGCTATTCCGGCGCCTCCACTCCGTCCCCCGCGGGTCTGCTCTGTGTGCCATGGACGGCATTGTCCCAGATATAGCCGTTGGTACAAAGCGGGGATCTGACGAGCTTTTCTCTACTTGTGTCACTAACGGACCGTTTATCATGAGCAGCAACTCGGCTTCTGCAGCAAACGGAAATGACAGCAAGAAGTTCAAAGGTGACAGCCGAAGTGCAGGCGTCCCCTCTAGAGTGATCCACATCCGGAAGCTCCCCATCGACGTCACGGAGGGGGAAGTCATCTCCCTGGGGCTGCCCTTTGGGAAGGTCACCAACCTCCTGATGCTGAAGGGGAAAAACCAGGCCTTCATCGAGATGAACACGGAGGAGGCTGCCAACACCATGGTGAACTACTACACCTCGGTGACCCCTGTGCTGCGCGGCCAGCCCATCTACATCCAGTTCTCCAACCACAAGGAGCTGAAGACCGACAGCTCTCCCAACCAGGCGCGGGCCCAGGCGGCCCTGCAGGCGGTGAACTCGGTCCAGTCGGGGAACCTGGCCTTGGCTGCCTCGGCGGCGGCCGTGGACGCAGGGATGGCGATGGCCGGGCAGAGCCCCGTGCTCAGGATCATCGTGGAGAACCTCTTCTACCCTGTGACCCTGGATGTGCTGCACCAGATTTTCTCCAAGTTCGGCACAGTGTTGAAGATCATCACCTTCACCAAGAACAACCAGTTCCAGGCCCTGCTGCAGTATGCGGACCCCGTGAGCGCCCAGCACGCCAAGCTGTCGCTGGACGGGCAGAACATCTACAACGCCTGCTGCACGCTGCGCATCGACTTTTCCAAGCTCACCAGCCTCAACGTCAAGTACAACAATGACAAGAGCCGTGACTACACACGCCCAGACCTGCCTTCCGGGGACAGCCAGCCCTCGCTGGACCAGACCATGGCCGCGGCCTTCGGTGCACCTGGTATAATCTCAGCCTCTCCGTATGCAGGAGCTGGTTTCCCTCCCACCTTTGCCATTCCTCAAGCTGCAGGCCTTTCCGTTCCGAACGTCCACGGCGCCCTGGCCCCCCTGGCCATCCCCTCGGCGGCGGCGGCAGCTGCGGCGGCAGGTCGGATCGCCATCCCGGGCCTGGCGGGGGCAGGAAATTCTGTATTGCTGGTCAGCAACCTCAACCCAGAGAGAGTCACACCCCAAAGCCTCTTTATTCTTTTCGGCGTCTACGGTGACGTGCAGCGCGTGAAGATCCTGTTCAATAAGAAGGAGAACGCCCTAGTGCAGATGGCGGACGGCAACCAGGCCCAGCTGGCCATGAGCCACCTGAACGGGCACAAGCTGCACGGGAAGCCCATCCGCATCACGCTCTCGAAGCACCAGAACGTGCAGCTGCCCCGCGAGGGCCAGGAGGACCAGGGCCTGACCAAGGACTACGGCAACTCACCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTGATCCAGATGGGCTCCGTGGAGGAGGCGGTCCAGGCCCTCATTGACCTGCACAACCACGACCTCGGGGAGAACCACCACCTGCGGGTCTCCTTCTCCAAGTCCACCATCTAGGGGCACAGGCCCCCACGGCCGGGCCCCCTGGCGACAACTTCCATCATTCCAGAGAAAAGCCACTTTAAAAACAGCTGAAGTGACCTTAGCAGACCAGAGATTTTATTTTTTTAAAGAGAAATCAGTTTACCTGTTTTTAAAAAAATTAAATCTAGTTCACCTTGCTCACCCTGCGGTGACAGGGACAGCTCAGGCTCTTGGTGACTGTGGCAGCGGGAGTTCCCGGCCCTCCACACCCGGGGCCAGACCCTCGGGGCCATGCCTTGGTGGGGCCTGTGTCGGGCGTGGGGCCTGCAGGTGGGCGCCCCGACCACGACTTGGCTTCCTTGTGCCTTAAAAAACCTGCCTTCCTGCAGCCACACACCCACCCGGGGTGTCCTGGGGACCCAAGGGGTGGGGGGGTCACACCAGAGAGAGGCAGGGGGCCTGGCCGGCTCCTGCAGGATCATGCAGCTGGGGCGCGGCGGCCGCGGCTGCGACACCCCAACCCCAGCCCTCTAATCAAGTCACGTGATTCTCCCTTCACCCCGCCCCCAGGGCCTTCCCTTCTGCCCCCAGGCGGGCTCCCCGCTGCTCCAGCTGCGGAGCTGGTCGACATAATCTCTGTATTATATACTTTGCAGTTGCAGACGTCTGTGCCTAGCAATATTTCCAGTTGACCAAATATTCTAATCTTTTTTCATTTATATGCAAAAGAAATAGTTTTAAGTAACTTTTTATAGCAAGATGATACAATGGTATGAGTGTAATCTAAACTTCCTTGTGGTATTACCTTGTATGCTGTTACTTTTATTTTATTCCTTGTAATTAAGTCACAGGCAGGACCCAGTTTCCAGAGAGCAGGCGGGGCCGCCCAGTGGGTCAGGCACAGGGAGCCCCGGTCCTATCTTAGAGCCCCTGAGCTTCAGGGAAGGGGCGGGCGTGTCGCCGCCTCTGGCATCGCCTCCGGTTGCCTTACACCACGCCTTCACCTGCAGTCGCCTAGAAAACTTGCTCTCAAACTTCAGGGTTTTTTCTTCCTTCAAATTTTGGACCAAAGTCTCATTTCTGTGTTTTGCCTGCCTCTGATGCTGGGACCCGGAAGGCGGGCGCTCCTCCTGTCTTCTCTGTGCTCTTTCTACCGCCCCCGCGTCCTGTCCCGGGGGCTCTCCTAGGATCCCCTTTCCGTAAAAGCGTGTAACAAGGGTGTAAATATTTATAATTTTTTATACCTGTTGTGAGACCCGAGGGGCGGCGGCGCGGTTTTTTATGGTGACACAAATGTATATTTTGCTAACAGCAATTCCAGGCTCAGTATTGTGACCGCGGAGCCACAGGGGACCCCACGCACATTCCGTTGCCTTACCCGATGGCTTGTGACGCGGAGAGAACCGATTAAAACCGTTTGAGAAACTCCTCCCTTGTCTAGCCCTGTGTTCGCTGTGGACGCTGTAGAGGCAGGT