Transcript asmbl_35197

Sequence
Transcript Sequence for observation asmbl_35197 of TGE0001954:
CAGGCACAGGAGGGCGGGCTAAAGAGGTCGCGGTCGCACGCGCAGTTGGTCCTTAGTACTGCGGCCGTGTGGGTGAGTTGGCTGCCGGTGAGTTGGGTGCCGGTGGAGTCGTGTTGGTCCTCAGAATCCCCGCGTAGCCGCTGCCTCCTCCTACCCTCGCCATGTTTCTTACCCGGTCTGAGTACGACAGGGGCGTGAATACTTTTTCTCCCGAAGGAAGATTATTTCAAGTGGAATATGCCATTGAGGCTATCAAGCTTGGTTCTACAGCCATTGGGATCCAGACATCAGAGGGTGTGTGCCTAGCTGTGGAGAAGAGAATTACTTCCCCACTGATGGAGCCCAGCAGCATTGAGAAAATTGTAGAGATTGATGCTCACATAGGTTGTGCCATGAGTGGGCTAATTGCTGATGCTAAGACTTTAATTGATAAAGCCAGAGTGGAGACACAGAACCACTGGTTCACCTACAATGAGACAATGACAGTGGAGAGTGTGACCCAAGCTGTGTCCAATCTGGCTTTGCAGTTTGGAGAAGAAGATGCAGATCCAGGTGCCATGTCTCGTCCCTTTGGAGTAGCATTATTATTTGGAGGAGTTGATGAGAAAGGACCCCAGCTGTTTCATATGGACCCATCTGGGACCTTTGTACAGTGTGATGCTCGAGCAATTGGCTCTGCTTCAGAGGGTGCCCAGAGCTCCTTGCAAGAAGTTTACCACAAGTCTATGACTTTGAAAGAAGCCATCAAGTCTTCACTCATCATCCTCAAACAAGTAATGGAGGAGAAGCTGAATGCAACAAACATTGAGCTAGCCACAGTGCAGCCTGGCCAGAATTTCCACATGTTCACAAAGGAAGAACTTGAAGAGGTTATCAAGGACATTTAAGGAATCCTGATCCTCAGAACTTCTCTGGGACAATTTCAGTTCTAATAATGTCCTTAAATTTTATTTCCAGCTCCTGTTCCTTGGAAAATCTCCATTGTATGTGCATTTTTTAAATGATGTCTGTACATAAAGGCAGTTCTGAAATAAAGAAAATTTT