Transcript asmbl_49586

Sequence
Transcript Sequence for observation asmbl_49586 of TGE0005978:
GAAGAATCTCTCTTTAGCTTCTGAAAAGAAGGTGGAAAAAAAGAAACTTCTTCAAAAATGTCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATACGTTAAAACTGTGAAAGCATCCAAAGGTGGTCCTGGGTCAGCAGTGAGCCCCTATCCTAGCTTCAATCCATCCTCAGATGTCGATGCCTTGCATAAAGCAATCATGGTTAAAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGAGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAAAAGGAAAGCCCCTGGATGAAGTTCTGAAGAAAGCCCTGACAGGTCACCTTGAAGAAGTTGCTTTGGCTCTATTAAAAACTCCAGCCCGGTTTGATGCTGATGAACTGCGTGCTGCCATGAAGGGCCTTGGAACAGATGAAGAGACTCTGGATGAAATTTTGGCATCAAGAACTAACAGAGAAATCAGAGAAATTAACAGAGTCTATAGAGAAGAATTGAAGAGAGATCTGGCTAAAGACATCACCTCAGACACATCTGGAGATTATCAGAAGGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGATATTGGCATAAATGAGGACTTGGCTGATTCAGATGCCAGGGCATTATATGAAGCAGGAGAAAGGAGAAAAGGGACAGATGTGAATGTGTTCACTACCATTCTTACCACCAGAAGCTACCCCCATCTTCGCAGAGTGTTTCAGAAGTACACCAAATACAGTCAGCATGACATGAACAAAGTTCTGGATCTGGAGATGAAAGGTGATATTGAGAAGTGCTTCACAACCATCGTGAAGTGTGCCACTAACAAACCAATGTTCTTTGCTGAGAAGCTTCATCAGGCCATGAAGGGTGCTGGAACGCGTCATAAGGCATTGATCAGAATTATGGTTTCCCGTTCTGAAATCGACATGAACGATATCAAAGCCTGCTATCAGAAGTTGTATGGTATCTCTCTCTGCCAAGCCATTCTGGATGAAACCAAAGGAGATTATGAAAAAATCCTGGTGGCTCTCTGCGGAGGACAGTAAATATTCCTTTAATGATCTCAAGCTTTTTGATCAGAAGATTTTTTAATCATATCTTTTCATTCCATATTACAGACTTAAATAGAAAAGTTTGTTCAGCAGAATTAGTTAGCTAACTGCTTTCTGAAAACTATGGCTTATAAATCATTTTTATATCATAACTCTGTATAATAGAGATAAGTTTTTTAAAAATTTATTTACCCCAATTATAAAACCCCACGAACAGGTTGTTCTAGTACCATTACTTGAGAAAGATGTTTATGTAACAGAAAATAAAATGATTTTACAGGACAATTGGTGTGTCATTGGTTCTTCTATTCTGATTTTTTTCTATGTGTAATGTAGTGGTTTAATTTGATATAAGGAGATAGGAACTTGAATTCTAAAT