Transcript asmbl_336631

Sequence
Transcript Sequence for observation asmbl_336631 of TGE0069404:
GGCGGGGCCGGCCCTCAGAGTCCTCTGACGGCCCCAGTCAGGGAATTTCAATTTGAAACCTAGCGGAGGGAGGAGGCAGGCGCGGCTGCCGGCGGCTGGGACTGAAGAGGGACGGGTCCCGCGGCGAGCGAGCTCCTGAGCATAAGCTGTGGCCATGACTACTGAAGTAGGCTCTGTGTCTGAAGTGAAGAAGGACTCTAGCCAGTTAGGAACAGATGCAACCAAGGAAAAACCTAAAGAAGTAGCAGAAAATCAGCAGAATCAGTCTTCCGATCCAGAGGAGGAAAAAGGTTCCCAGCCACCTCCTGCAGCTGAAAGCCAAAGTAGTCTACGCCGCCAGAAGAGAGAGAAGGAAACATCGGAGAGCAGGGGTATTTCTCGGTTCATACCGCCATGGCTTAAGAAGCAAAAGTCATATACCTTAGTAGTGGCCAAAGATGGAGGAGATAAAAAAGAGCCTACCCAAGCTGTTGTTGAAGAACAGGTCTTAGATAAAGAGGAACCCCTTCCAGAAGAACAGAGACAGGCTAAGGGTGATGCTGAAGAAATGGCTCAGAAGAAACAAGAGATTAAAGTTGAAGTCAAGGAAGAAAAACCCTCAGTGAGCAAGGAAGAAAAACCCTCAGTGAGCAAAGTGGAGATGCAGCCTACTGAATTAGTAAGTAAGGAGAGAGAAGAGAAGGTAAAAGAAACACAGGAAGACAAATTAGAAGGAGGAGCAGCAAAAAGGGAGACCAAGGAAGTGCAGACCAATGAGCTGAAAGCAGAGAAGGCATCTCAAAAAGTCACCAAGAAGACCAAAACTGTCCAGTGTAAAGTGACCCTCTTAGATGGCACCGAATACAGCTGTGACCTGGAGAAACATGCCAAGGGACAAGTGTTATTTGACAAAGTGTGTGAACACCTCAATCTCTTGGAGAAAGACTACTTTGGACTTTTGTTTCAGGAAAGCCCTGAGCAGAAAAACTGGTTAGATCCTGCTAAAGAAATAAAGAGACAACTGAGAAACCTTCCATGGCTATTCACTTTTAATGTGAAGTTTTATCCTCCTGATCCTTCTCAATTGACTGAAGATATCACCAGATACTTCTTGTGCCTTCAGCTCCGGCAGGACATTGCCTCTGGCCGCCTGCCCTGCTCTTTTGTGACTCATGCTCTCCTGGGATCCTACACCCTGCAGGCTGAACTTGGTGACTATGACCCAGAAGAACATGGCAGCATCGACCTCAGTGAATTCCAGTTTGCCCCTACTCAGACTAAGGAGCTGGAAGAGAAGGTGGCAGAGCTGCACAAAACCCACAGGGGCTTATCGCCAGCACAAGCTGATTCCCAGTTCTTAGAAAATGCAAAGAGGCTTTCCATGTATGGTGTTGACCTACATCATGCCAAGGACTCAGAAGGTGTGGACATCAAGCTGGGCGTGTGTGCTAATGGACTTCTCATTTACAAAGACAGACTGCGAATCAATCGTTTTGCTTGGCCGAAAATCTTAAAAATTTCCTATAAACGCAGTAACTTCTACATTAAAGTCAGACCGGCAGAGCTGGAACAGTTTGAGAGTACCATTGGATTCAAACTGCCAAACCACCGGGCAGCGAAAAGACTATGGAAAGTGTGCGTGGAGCATCATACTTTCTACAGGCTTGTTTCTCCAGAGCAGCCACCAAAAGCCAAGTTCCTGACCTTGGGGTCCAAATTTCGCTATAGTGGCCGCACCCAAGCACAGACCCGCCAGGCCAGCACCCTCATAGATAGGCCAGCACCACACTTTGAGCGCACTTCTAGTAAACGGGTCTCCAGGAGTCTAGATGGAGCTCCGATTGGTGTCATGGACCAAAGTCTTATGAAGGATTTTCCTGGCGCTGCTGGGGAGATTTCAGCCTATGGACCTGGACTTGTCAGCATTGCCGTGGTACAAGATGGGGACGGCAGGAGGGAAGTGAGAAGCCCAACTAAAGCCCCACATTTGCAGCTCATTGAAGGAAAGAAAAATTCCTTGAGAGTAGAAGGGGATAATATTTATGT