Transcript asmbl_49552

Sequence
Transcript Sequence for observation asmbl_49552 of TGE0005972:
CTCCATTCTGCGGTCCCAGAGCTTGAAGGCCTCTGCCACGGTCACCGTGACCCCGCGCCTCTGCCGCCCCCCGGCAGGTGTGATCTCCCCTGAGGACCACAGGGAAGCTCATCTCCCTGCTTGGCTTCTACCTTTAACTCTTGGGAGCATCCCCTAACACATCCAAACTACAATCCAGACCCAAGAGGGCAAAGTCCAGAAAGAGGTCAAGATGGGGTTTATATTTTCAAAAGCTATGAATGAAAACATGAAAAACCAACAGGAGTTTGCGTTAATGAATGCTCGACTTCAGCTAGAAAGGCAGCTAATAATGCAGAATGAAATGAGAGAAAGACAAATGGCCATGCAGATTGCTTGGTCTCGAGAATTCCTCAAATATTTCGGAACATTTTGTAGCCTTGCAGCAATCTCTTTAACAGCTGGAGCAATAAAAAGGAAGAAGCCAGCCTTCCTCTTTCCTCTTGTTCCATTAGGCTTTGTCTTTACCTACCAGTATGATTTAGGCTATGGAACCCTTCTACAAAGAATGAAAGGTGAAGCCGAGAACATACTGGAATCAGAAAAGAGTACATTGCAGTTGCCAAAAGGAATGATTACTTTCGAAAGCCTTGAACAAGCCAGAAAGGAACAAAGTAAATTCTTCATAGACAAATGAAATCATGTTTACCCACCAAATCTCAAAACACAGAATTGTTGACTCGAATCATGGTTTTTACAATTTCTTAAATGCTCGAGATCTTGATGTAATGGATTTTATTTTTAAATTTTAAAAATCAGTTTTGTTAAACTATTTTAAAGTAAAATTTATAACATTCAACAAAAAATGGAGGTTCTCTAAGTAACTTTCAGATTTCCTATATGTGTGTGTGTGTATAATAAATAAATGTGAAATTAATAAACTATGTTGTTTTGAATTCCTGAAA