Transcript asmbl_336275

Sequence
Transcript Sequence for observation asmbl_336275 of TGE0002382:
GCCGCAGGCCGAGGCTGGCGCAGAGAGACAGGAAGCGCCAGCTCTGGGCGTCTGGGTCCTCGCCTCCTCGGCCGCAGCCCCGCGGCGGCGCGCTCGCGGTGCATTGTGGGCGCTGTAGTCCGGCCGGAACCTGTTTGCGACCCCGAGTCCCATGACACCGCTTCTCCTCACACCCCAGTCCGCAGTGCCCCTCCCCAGCCTCGGCCGGGCCTCCCGGGAGCCGGGCGTGGCGTTCCAGCTAGTGAGCCGTTTCTCCCCTGGGCTCGGAGGCGGAAGCTTGAGGGGCGCGGGGAGGAGCTTCGCGTGCGGGGTGAACGCCCGCTCTACGTGCTCGTTCTCTTCGCGACCGCTGCGCGCGAGCCCCGTGTCCCCACGGCGGGCAGCAGCGGCGGCGGCGGCGGCTGAACGCGGAGGGGGCGGAGGGAGCCCGCGGCGGCGGCAGCAGCTACAGCGAAATGGCGGAGACCGTGGCTGACACCCGGCGGCTGATCACCAAGCCGCAGAACCTGAATGACGCCTACGGACCCCCCAGCAACTTCCTCGAGATCGATGTGAGCAACCCGCAAACGGTGGGGGTCGGCCGGGGCCGCTTCACCACTTACGAAATCAGGGTCAAGACAAATCTTCCTATTTTCAAGCTGAAAGAATCTACTGTTAGAAGAAGATACAGTGACTTTGAATGGCTGCGAAGTGAATTAGAAAGAGAGAGCAAGGTCGTAGTTCCCCCGCTCCCTGGGAAAGCGTTTTTGCGTCAGCTTCCTTTTAGAGGAGATGATGGAATATTTGATGACAATTTTATTGAGGAAAGAAAACAAGGGCTGGAGCAGTTTATAAACAAGGTCGCTGGTCATCCTCTGGCACAGAACGAACGTTGTCTTCACATGTTTTTACAAGATGAAATAATAGATAAAAGCTATACTCCATCTAAAATAAGACATGCCTGAAATTTGGCAAGAAGGGGCAAAAACGTGACTATTAATGATTGATAAGCACCAGTGAAGAAGTTCTAACTTTTAGCATGCTGCACAGAAACTGGTATAACATGCCTTCAGTATACTAACACTCATATGCTCAGTTTTGTTTTGTTTTGGCAGTTGACAAGAAGTTAATTTGCTTTAGTAAAAATCCCTCATTCCAGCCTTTCTATATAAATAGCTCTTTCTTGCTGTTTTAATGTGGTGCACACTATAGCCTCACAAACCTGTTATTCCAGTGTAATCTGCAGTGTCGTAACTAAAGTTACTGGCTTGGTCTTATTTGCACAGTTTTTGCGTCTTGTTTGCTTCTTGCATCTGATTAACTAGAATATTTCTCTTTCCCCCTTTTAATTTGTGATGTCACTTGACCCCATTTATGTGTAGGAGCACTACACCATTGGTTTCCAATACTGCACACATAAGATACATACTTGTGTGCAGAAAGTATCTTCCTCCAGGCTTGTAATACCCTTCACATGGAAGATTAATGAGGGAAATCTTTATATTCTGTATAAAAACAAAAGCAAATTTATATACTAAAATCATTTGTCTAAAAATTTAAGTTGTTTTCAAATAAAAATTAAAATGCATTTCTGATATGCACTGATTGTGTTGCCTCCAGCTTTTTTTGCTCTCTATGAGTGACTACTTAAGTCACTTGTTGAGAGGGATTATTTACTAATTATATACTTCTCATTCCTGTAACTCCATTCCCTTTAAACAGTGGTGATATCAAATATACTTCCATCCATTGAATGGGGTATTTTTAACAACAACAAAAGTGATATACTAAAAAATGTATTGCTTAAGGCTTATTGAATCATTTTGAAGCACTTTGTGTATTTGAAAACTGCTTTATAATCTCATTTATTAAAAGGAC