Transcript asmbl_49514

Sequence
Transcript Sequence for observation asmbl_49514 of TGE0005969:
GCAGGCTTGTCGGGACATCCAAGGCATTCCCTCAGCTTCTGCCGCCCCGGGATCCTCGGCTCTGGTCCGTCTCCCTGCATCTTCCCGCTGTACCGCTGCACCTCCTCCCTCCTGGGCTTCGGACCCCGGGCATCGCCCCTCCTGAAACATGACTCGCGATTTCAAACCTGGAGACCTCATCTTCGCCAAGATGAAAGGTTATCCTCATTGGCCAGCTCGAGTAGATGAAGTTCCTGATGGAGCTGTAAAACCACCTACAAACAAACTACCCATTTTCTTTTTTGGAACTCATGAGACTGCTTTTTTAGGCCCAAAGGATATATTTCCTTACTCAGAAAATAAGGAAAAGTACGGAAAACCAAATAAACGAAAAGGCTTTAATGAAGGTTTATGGGAGATAGATAACAATCCGAAAGTGAAATTTTCAAGTCAACAGGCATCAGCTAAACAATCAAATGCATCATCTGATGTTGAAGTTGAAGAAAAAGAAACTAGTGTTTCAAAGGAAGATACTGACCATGAAGAAAAAGGCAGCAATGAGGATATGACTAAAGCAATTGACATAACTACGCCAAAAGCTGCCAGAAGAGGGAGAAAGAGAAAGGCAGAAAAGCAAGTAGAAACCGAGGAGGCAGGAGTAGTGACAACAGCAACAGCATCTGTTAATCTAAAAGTGAGTCCTAAAAGAGGACGACCTGCAGCTACAGAAGTAAAGATTCCAAAACCAAGAGGCAGACCCAAAATGGTAAAACAGACCTGTCCTTCAGAGAGCGACATGGTAACTGAAGAAGACAAAAGTAAGAAAAAAGGGCAAGAGGAAAAACAACCTAAAAAGCAGCTTAAAAAGGATGAAGAAGGCCAGAAGGAAGAAGATAAACCAAGAAAAGAGCCAGATAAAAAAGAGGGGAAGAAAGAAACTGAATCAAAAAGGAAAAATTTAGCTAAAACGGGGGTCACATCAACCTCCGATTCTGAAGAGGAAGGAGATGATCAAGAGGGTGAAAAGAAGAGAAAAGGTGGAAGAAACTTTCAGACTGCTCATAGAAGGAATATGCTGAAAGGCCAACATGAGAAAGAAGCAGCGGATAGAAAACGCAAGCAAGAGGAACAAATGGAAACTGAGCAGCAGAATAAAGATGAAGGAAAGAAGCCAGAAGTTAAGAAAGTGGAGAAGAAGCGAGAAACATCAATGGATTCTCGACTTCAAAGGATACATGCTGAAATAAAAAATTCACTCAAAATTGATAATCTTGATGTGAACAGATGTATTGAAGCCTTGGATGAACTTGCTTCACTTCAGGTAACAATGCAACAAGCTCAGAAACACACAGAGATGATTACAACACTGAAAAAAATACGACGATTCAAAGTGAGTCAGATTATCATGGAAAAGTCTACAATGTTGTATAACAAGTTTAAGAACATGTTTTTGGTTGGTGAAGGAGATTCTGTAATCACACAAGTGCTGAATAAATCTCTGGCTGAACAAAGACAGCATGAGGAAGCAAATAAAACCAAAGATCAAGGGAAGAAAGGGCCAAACAAAAAGCTAGAAAAGGAACAAACAGGTTCAAAGACTCTAAATGGAGGATCTGATGCTCAAGACAGTAATCAACCACAGCATAATGGAGATAGCAATGAAGAAAGCAAAGACGAGGCCAGCAGTAAGAAAAAGTGAGGACATGTTTTAATGGGTCGTAATGTGTACTTTTTGTTTAATTTTTAAATCACAGTGTTGTTCCAAGGTTATTTGTAGTAAGGTATTATATTTTGATCACTCAGTTCCTGAATTCAGAAAGCAAGTTACAAATCAAAAAGATGTAGAAATTAAGTTATAACTAATTTCACTGTATTCAAGGGAATAGAGCGAGGCAGGAATTTTAGTTTTAAAAAATAATTTTTGGACTTCTTTCACTGATACTTTTAATAATGACTTAAAAGTCTATACTTTCTTGAATTTCGACAGGATAATAAAAAAATTAGACCTAAATCACAGGCTAGTTTGTATTATAAATACCCACTCTAACTAGATATGGAACTGTAGTTACCAAGTCTTGGTTTGTTCCTCTGTATATCAAGACTTGGAATCAAGCATCCCTTCTAATTCTGAAACTGAGAGAAATCTCATCTGTGTGATACTATCCCCTCTTTTCATTAAGGTTTGTACTATGTTGGTATCACAGGTGTGACATTCTTATGTTCTTAGAATTCATTTTAAAGCTGGATATGATGA