Transcript asmbl_333975

Sequence
Transcript Sequence for observation asmbl_333975 of TGE0002309:
GGACCGGAGGGGGTTTCCGCTTCCGGGAGAGGCTGACCGTTTCCGCTTCCGTCCACTTGGCGAGTGAGACGCTGATGGGAGGATGGACGTACTGGTGTCTGAGTGCTCCGCGCGGCTGCTGCAGCAGGAAGAAGAGATTAAATCTCTGACTGCTGAAATTGACCGGTTGAAAAACTGTGGCTGTTTAGGAGCTTCTCCAAATTTGGAGCAGTTACAAGAAGAAAATTTAAAATTAAAGTATCGACTGAATATTCTTCGAAAGAGTCTTCAGGCAGAAAGGAACAAACCAACTAAAAATATGATTAACATTATTAGCCGCCTACAAGAGGTCTTTGGTCATGCAATTAAGGCTGCATATCCAGATTTGGAAAATCCTCCTCTGCTAGTGACACCAAGTCAGCAGGCCAAGTTTGGGGACTATCAGTGTAATAGTGCTATGGGTATTTCTCAGATGCTCAAAACCAAGGAACAGAAAGTTAATCCAAGAGAAATTGCTGAAAACATTACCAAACACCTCCCAGACAATGAATGTATTGAAAAAGTTGAAATTGCTGGTCCTGGTTTTATTAATGTCCACTTAAGAAAGGATTTTGTATCAGAACAATTGACCAGTCTTCTAGTGAATGGAGTTCAACTACCTGCTCTGGGAGAGAATAAAAAGGTTATAGTTGACTTTTCCTCCCCTAATATAGCTAAAGAGATGCATGTAGGCCACCTGAGGTCAACTATCATAGGAGAGAGTATAAGCCGCCTCTTTGAATTTGCAGGGTATGACGTGCTCAGGTTAAATCATGTAGGAGACTGGGGGACCCAGTTTGGCATGCTCATCGCTCACCTGCAAGACAAATTTCCAGATTATCTAACAGTTTCACCTCCTATTGGGGATCTTCAGGTCTTTTATAAGGAATCTAAGAAGAGGTTTGATACTGAGGAGGAATTTAAGAAGCGAGCATATCAGTGTGTAGTTCTGCTCCAGGGTAAAAACCCAGATATTACAAAAGCTTGGAAGCTTATCTGTGATGTCTCCCGCCAAGAGTTAAATAAAATCTATGATGCATTGGACGTCTCTTTAATAGAGAGAGGGGAATCCTTCTATCAAGATAGGATGAATGATATTGTAAAGGAATTTGAAGATAGAGGATTTGTGCAGGTGGATGATGGCAGAAAGATTGTATTTGTCCCAGGGTGTTCCATACCATTAACCATAGTAAAATCAGATGGAGGTTATACCTATGATACATCTGACCTGGCTGCTATTAAACAAAGACTATTTGAGGAAAAAGCAGATATGATTATCTATGTTGTGGACAATGGACAATCTGTGCACTTCCAGACAATATTTGCTGCTGCTCAAATGATTGGTTGGTATGACCCTAAAGTAACTCGAGTCTTCCATGCTGGATTTGGTGTGGTGCTAGGGGAAGACAAGAAAAAGTTTAAAACACGTTCGGGTGAAACAGTGCGCCTCATGGATCTTCTGGGAGAAGGACTAAAACGATCCATGGACAAGTTGAAGGAAAAAGAAAGAGACAAGGTCTTAACTGCAGAGGAATTGAATGCTGCTCAGACATCCGTTGCGTATGGCTGCATCAAATATGCTGACCTTTCCCATAACCGGTTGAATGACTACATCTTCTCCTTTGACAAAATGCTAGATGACAGAGGAAATACAGCTGCTTACTTGTTGTATGCCTTCACTAGAATCAGGTCTATTGCACGTCTGGCCAATATTGATGAAGAAATGCTCCAAAAAGCTGCTCGAGAAACCAAGATTCTTTTGGATCATGAGAAGGAATGGAAACTAGGCCGGTGCATTTTACGGTTCCCTGAGATTCTGCAAAAGATTTTAGATGACTTATTTCTCCACACTCTCTGTGATTATATATATGAGCTGGCAACTGCTTTCACAGAGTTCTATGATAGCTGCTACTGTGTGGAGAAAGATAGACAGACTGGAAAAATATTGAAGGTGAACATGTGGCGTATGCTGCTATGTGAAGCAGTAGCTGCTGTCATGGCCAAGGGGTTTGATATCCTGGGAATAAAACCTGTCCAAAGGATGTAATCCTTCATAGGTTTGAACACTGTGTGTTTTTACCAAAGTGGCCATTGGCACTGTTTGCTTTTTTACAATCATGTGGACACAAGCATAAGTAAAGAAAATTTGTCAACCAGGCAAAATGTGGTTCTTTAACAGCTAGAATTCTAAAAAGAAAAAAATCACTTCCACAAATATGCTTATATCTTGCTGAGCATTAAACCAAAATGACTTAGTGGAGGCCATGAAATAACAGGATTTATGCACCACAGTGAGAGTGTATTGACTTTGCAGGAATGTGGTTTATTAATTTTAATTAGATAAGGAATCCCATTTGTTGACCCTGAAAGGGCCCCAAGAATTTACGCCTCTTCATTGTCCCATTCATGTCTCATTTCATTGTTCTGTGAGAGATACTTAGCCTGTTTTACAAGTAACAAAACTTGAGACTGCACAGAGATAAGTAATTTGCCCTGGAATCCTCAGGAACAAAATTAAGATTCACACCCGTGCATGTTTAAAATCCCAAATTCAGGCTATTTCCATTTTAAGAGAAGGTGACATTGGCAATATAACAGACTTGGGTTCGGGGGAAGGGGGCAAGGAAATGTAGACTGGCAATTTTCCTGAAGCTCAAGATTAACTCTTAACATCTCATTGGCCAGATGCCAATCCCAGTTGCAAAGGAAGGTAGAAACCTAGAGTGAATGTCCAAGCTAAGAAGAGGATTGCTGTGATTTCCCTAGACCAGTCACAATTCATCCCCTGGGCAGGGCATATTGTCTCATTTCATGAAATTGGAATCTTTGTAGCAGCACAGAATATGGAGATTGGCAGTGGCAGCGAGAGGTTTTGGGGTACAGCTCCGCACACTGATTATTGAGTCAGCAGTTAATGGAATCTGCCAACACAAAACTGAAATGAGATTCCATGTAAAGCCAACACAATAGAAAAATGAATGTTT