Transcript asmbl_333952

Sequence
Transcript Sequence for observation asmbl_333952 of TGE0002306:
CATACTTTTCACTGAAAAAGTTTGAGTTTTTTAAATGAGCAGATACTCATGCATTACTAGTGCAGCCAAAAATTATCAAAAGTAGGGAAGAATGCAAAATAGCGTGTGCCTCTTAACTAAAGAACTGTTAAGATACAAAACTTGGCTCTTTGCTGCCTTTCCCGCACTGCCAAGAGGGAAACATGAATTAGTTACATTGCCGTGGTGCTCACTGGGAGTTCGCTGTATGGACCAGATGGGTACTGCTCCGAATTTCCATTCAAGTCTGACATTCTTTTGTCAGCGTTTGTGTAACCGGTTTTCCTTGCATTCAGAGGAAAGACAGCATGGAAGTATGGATGGGAAGGTTGAGACGATTGGATACTGTATGGTAACCTCGATCGCAGCTCTCCTATGAGACTTGCTTCTTGGATTCTGAGTCACTTAAGCTTGCCCCTTCTCTTTCCTGACCCTCTTCCGTTTCCCCTTAGATTGGAGATTCTCCTCAGATTCTAAGTCTCTGAAATTATTAGTGTTGGCAGCCCCTGGGCCCATGGAGGGGTCTCAAGTCTTCAGTTCTCAAAGATCACCTTTTAAGCTTCATTCGGAACATGACACAGCCACACGAGTCCTAGCCCTGAATCTCACGAAGACCTCAGTACACCTGGAAAAGGCAGCACACCCAGTTACGACACTACTAGAGACGTCACACGCCTCAGCACCCATCCGCTCCCAGCCCAGAACGAGCGCACGCGCAGAACGAGAGAGCGGCCACCCAGGGATCGGCGCTATCTGCACAGCGGTTACAGTCTCGGAAAGGCCTGGCTTCTTCGTGGCTTTGTGGAGATCCCTTACAGCGGCCATTTGATTAGCACCCGAAGAGATTCAAAGGAAGCAGTTGTTCCGTCCCCAACATATTTCCGTTTCAAACCACCCACTTCCGGTTTTTCAGCCGGTTCCGGTCCCGCCCTTCACTTCCGGTCGCTTTCGGTCTCTCAGCGGCCGGTTTCTGCGTCCGCTGCCGCAGGTTCCACCGCGCTCCAGGTATTTTTTTTTCTGAAGGAAAGCTGCTTCCTCATATGTTTCAAGAATGGCTCTCCCTATCATTGTAAAATGGGGTGGACAGGAGTATTCAGTGACCACACTTTCAGAAGATGATACTGTGCTCGATCTCAAACAGTTTCTCAAGACCCTTACAGGAGTTCTTCCAGAACGCCAAAAGTTACTTGGACTCAAAGTTAAAGGCAAACCTGCAGAAAATGATGTTAAGCTTGGAGCTCTCAAACTGAAACCAAATACTAAAATCATGATGATGGGAACTCGTGAGGAGAGCTTGGAAGATGTCTTAGGTCCACCCCCTGACAATGATGATGTTGTTAATGACTTTGATATTGAAGATGAAGTAGTTGAAGTAGAAAATAGGGAAGAAAACCTACTGAAAATTTCTCGCAGAGTGAAAGAGTACAAAGTGGAAATTTTGAATCCTCCCAGGGAAGGGAAAAAGCTTTTGGTGCTAGATGTTGATTATACATTATTTGACCACAGGTCTTGTGCAGAGACTGGGGTAGAATTAATGCGGCCATATCTTCATGAATTTCTAACATCTGCCTATGAAGATTATGACATTGTTATTTGGTCTGCAACAAATATGAAGTGGATTGAAGCTAAAATGAAAGAGCTGGGAGTGAGCACAAATGCAAATTATAAGATTACTTTCATGTTGGATAGTGCTGCTATGATAACAGTACATACTCCAAGGAGAGGATTAATAGACGTAAAGCCTCTTGGTGTTATATGGGGAAAGTTTTCGGAGTTTTACAGCAAGAAAAACACCATTATGTTTGATGACATAGGGAGAAATTTTCTAATGAACCCACAGAATGGACTAAAGATAAGGCCTTTTATGAAAGCGCACCTAAATCGTGATAAAGACAAAGAACTTTTAAAATTAACTCAGTACCTCAAGGAGATAGCAAAATTAGATGACTTTTTGGATCTAAATCACAAATATTGGGAAAGATATCTCTCAAAGAAGCAAGGACAGTAGTTACAAGTTATACTGGCAGTTATTGAAGATACTTAAGATCCAAGAACTTCTTGCTTTTATGCTAGAAATCATTATGATAGTGCTGGACACTGAAGCAAATACCATACTGCTTATACTTGGTCTTCCAGTTTTTTGTAAATTTAATTTTATATTTTTTGAAGATGATAGCAATATGCTAAAAAATGCTTGTCCCCTATATGAATATTCTGTTACGCTTGAAAAATATTTTCTCCAGCGTTGGTTACTGACCACCCCACCCTCCCACCACACACACACACACACAC