Transcript asmbl_49399

Sequence
Transcript Sequence for observation asmbl_49399 of TGE0005955:
GCGAGCTGGGCGCGAGGCGCGCAGGCGCCTTGGGGACCCGGTAGCGGCGGTGGCAGTGGCTGCGGCGACGGGATCCTTGGCCGAAACTGAAGGCGGTGGTGGCGGCCATGGCGGCCGATGGAGAGCGATCCCCGCTGCTCTCCGAGCCCATCGATGGTGGTGCTGGCGGCAATGGATTAGTGGGACCAGGCGGGAGTGGGGCTGGGCCCGGGGGAGGCCTGACCCCCTCCGCACCACCGTACGGAGCCGGTAAACATACCCCGCCCCAGGCATTTCCCCCATTCCCTGAGGGACATCCAGCCGTGTTGCCTGGGGAGGACCCACCCCCCTACTCACCCTTGACTAGCCCGGACAGTGGGAATGCTCCCATGATCACCTGCCGAGTCTGCCAGTCTCTCATCAACGTGGAAGGCAAGATGCATCAGCATGTAGTCAAATGTGGCGTCTGCAATGAAGCCACTCCAATCAAGAATGCACCCCCAGGGAAAAAATATGTTCGATGCCCTTGTAACTGTCTCCTTATCTGCAAAGTAACTTCCCAGCGGATTGCCTGCCCTCGACCCTACTGCAAAAGAATCATCAACCTGGGGCCTGTGCACCCAGGACCTCTGAGTCCAGAACAACAACCTGTAGGTGTCAGGGTCATCTGTGGACATTGCAAGAATACTTTTCTGTGGACGGAGTTCACAGACCGAACCTTGGCCCGTTGCCCTCACTGCAGGAAAGTGTCATCTATTGGGCGCAGATATCCACGAAAGAGGTGTATCTGCTGCTTCTTGCTTGGCTTACTCTTGGCAGTCACTGCCACTGGCCTTGCCTTTGGGACATGGAAGCATGCACAGCAATATGGAGGCATCTATGCAGCCTGGGCATTTGTGATCCTGTTGGCTGTGCTGTGTTTGGGGCGGGCCTTCTATTGGGCCTGTATGAAGGTCAGCCACCCTGTCCAGAACTTCTCCTGAGCCCCATGATCACCCACAGACTGTGCCTGGCCCCTTCCTGGTGGGGACAGTGACACTACAAAGGGAACCATAATCAAAGGCTCCCTGGGCTTCTATAAGGGAAGCCAAGCAGCTGCCTTCCTTTTCCCTGGCGAGAGGTAGGAAGGGACCAGGCCCTCACCTAGGTTTGGAGGGGTAGAAAAGGCCACTGTTGGCCTGGCCACCTGCTTTCCTCCAAGAGTTGCTATGTTTAGGGTGAGGTAGGTGAAATGTTGCCCCTAAACCTGGGTCATAAAAGATGGTTCTAGCCATGTCCTTCCTATGTGCTCCCTGAGAGCCATTCCTGTCCCTTACACATTCCAGGGCAGGGTGGGGGTGGGTAGCCCTGGGGGTTTCCCTCCCTCTTGTGTACCATTAGGACCTTGCTGCTGCTATTGCACTTCACCAGGGGCTGGCTCTGGCCTCAGTACCCTCAGTCTCCTCCCCCCATTCCATGTCCTATGGGGGTGGGGTCAGCCGCTGCTCTGTACAGAACCACAGGAACTGATATGTATATAACTATTTAATATGGGGAATGTCCCCCTAGTCCTGTGTTTCCCTTAATTCCTCCTTCCAACCTTACTCCCCAGTGTATTTAACTGGGCTGGGTAGGGTTGCTCTGTTGTGGGGGAGGTTAGGGATTCATCCTGTGCTTGTAAATAAATAAGGTCGTGACTACCCTT