Transcript asmbl_49297

Sequence
Transcript Sequence for observation asmbl_49297 of TGE0009897:
CGGAGGCGACGACGGGGCGGCCTCAAGGAGTCGCAACGAGCCAGAGCGCGTCACGCCCTGGTGCTGCGGTGGTCGCTCGCGTCTTGTCGGCCCGTTCCGTGTTGCCCTGCACTGCCGCGGCCGCCGCGGAACCATGGCTGTGCTCGTCGTGCTGTTGTCCTTGGTGGCGGGTGTTTTGGGAAACGAGTTTAGTATTTTAAGATCACCGGGGTCTGTTGTTTTCCGGGATGGAAATTGGCCTATACCAGGAGAGCGAATCCCAGATGTTGCTGCATTATCCATGGGCTTCTCTGTGAAAGAAGATCTTTCTTGGCCAGGACTTGCAGTTGGTAACCTATTCCATCGTCCTCGGGCTACCGTTATGGTGATGGTGAAGGGAGTGGACAAACTCGCTCTACCCCCAGGCAGTGCCATTTCATACCCTTTGGAGAATGCAGTTCCTTTTAGTCTCGACAGTGTTGCAAATTCCATTCACTCCTTATTTTCTGAAGAAACTCCTGTAGTTTTGCAGTTGGCTCCCAGTGAGGAAAGAGTGTATATGGTGGGAAAGGCAAACTCAGTTTTTGAAGATCTTTCAGTAACGTTACGACAGCTCCGCAATCGCCTGTTTCAAGAAAATTCCATTCTCAATGCACTTCCCCTCAATTCTCTGAGTAGGAACAATGAAGTTGATCTGCTCTTTCTTTCTGAACTGCAAGTTCTACATGATATTTCAAGTTTGTTGTCTCGACATAAGCATCTAGCCAAGGATCATTCTCCTGATTTATATTCACTGGAGCTGGCAGGTTTGGATGAAATTGGGAAACATTATGGGGAAGACTCTGAACAATTCAGAGATGCTTCTAAGATCCTTGTTGACGCTCTGCAAAAGTTTGCAGATGACATGTATAGTCTTTATGGTGGGAATGCAGTGGTAGAGCTAGTGACTGTCAGATCATTCGACACATCCCTTGTGAGGAAGACAAGGACTATCCTTGAGGCAAAACAAGAGAACCCACCAAGTCCCTTTAACCTTGCATATAAGTATAATTTTGAGTATCCAGTGGTTTTCAATATGGTACTTTGGATAATGATCGCCTTGGCCTTGGCTGTGATTATCACCTCTTACAATATTTGGAACATGGATCCTGGATATGATAGCATCATTTATAGGATGACAAACCAGAAGATTCGAATGGATTGAACTTTCCTTATGCCTAACTTAGAAAAGGGGTTTGGAAATTGTTTTCTTAAAATAAATCTTTAGTGTAGTTTAAAGTAGATAGTATACTTTAAATTTTTTAAAGAAGTAAATTTTGTTCTCAGTTTTGTGTGTGCTTGTGAAGTTGTTTTAGAGTGAATTATGGTATTGATGTGAATTGATTTGTGTGATATAAATTCCATAATATCCTCAAATATTATGATATAACCATTTAATATAATTTCATTCCATTTAATATTTGGAAATAATGCACTGAAATAAATGTAAAACATTTAGAATAGCTTGTGTTATTTATGTTAGGAAAATGCACTGAATTTGTTAGAGGCACTTATGAATGCTTAATTTCCTTACACAGGACAGATTTAAATGATATTTGGGCTATTGTGTACTATGAACTATTTGTAAATGTCCTAATTTGATGTAAATATCTCTGAAACGAGAAATGGTTTTCACTTAGCACAGCCCTCAACTATGAGTGTGTGTATACAGTCACTTTGATTTGGAACTGCATCTGATTGACAGAGGATAGCTGTTTTTTTAACCTCTTCTGAAAGTTTGGTGATCTGGATGGTCTAGTGTGGGTATTAAAAATACTACATTGATCTCAGAAGAAACTAGCTTTGTGAAGTTACAGATATTCATAATTATACACATAAAAACAAACATTTGGGGGACATCTTGGGGCATGAATATAAAAATCTTTTTATTTCAGTTAACTTTTCCCACTGTGTAAGTTACTATGGTTTGTGGTACATCATTCTATAGAATATTAAGTGAAAGTAGATGCTCCTTACTTTTCATGTGGAAGTGGACCAATGTCTATAAAGAGTCACAAATAAAGTTAATGATTCCAAA