Transcript asmbl_32051

Sequence
Transcript Sequence for observation asmbl_32051 of TGE0069147:
GCTGGGATTACAAGTATGAGCCACCACACCCGGCTTCTCACCACATATCTCAAGAGCAAAAACACTGTATCTAATTGGTCTTTGAAAATCACAGCCACTGTTAAAGTAGGTACCTACCATTTGTTCAATGAAATCAATGAAGAATGAAAGACAAGCTTACAATGATATTTGCCTTGAAATGCAGAATGAAGCAAAACAGTTACGGAAATTGTCATAATATAATTACTGTAGAGTAGCTCAAAACATCTACTCTCTCAGAACTATCAAAATACTACTTCACTTAAAGGCAGAACAATGACAAGTATACCTAAAATGTTACATGAAGTTACACAGGGAACATTAAGTGAAAGAGATTCCAGTAGACTATTTTAAAAGATTTTATTAGAGGAAATAATCTAGTAGATAACTTTCTTACTTCCACAAAAACAAAGTTTCTCAAGGATACAAACCAATGGATTTATCTGTGAACTCGGTCCCAGAATAGAAACTAGCAAAAAGTCAGTACAGTACTCAAAAAATACTTTTGTGGTATGAAAAAAGGGCAGGTGCAGATGTAGAACTGTACCATCTTCAGTTTCTGTTCACAATTGTTTTAAAACAATTCTCATCTATCCAGTCTGCTCTCCCACGCCTCAGATGAGGGAAGCCAATGGTCAATGCTCTGTGATAGCCCAAGTAGGATCCAATCTAGGTAATCCCTGTCCACCTTAGCTCTGTCCTCTGAGGGATTTGCCAGGTTGCACCACAATAGTTCTCCATTCTCTTTAGTCTGAACTTATGCTGTAAACCCAAGGCCTGGCACAGGGGTATGCAGGAAAGTTTGAGTGAATCAGTCACAACAGCTCTAGTACAGTACTGCATCGATATGCTCTGGAGACCTGCAGCCTATTTTTCCCAGAGAAATAAAGTGGAGTGGAGATCAGAAGCCATGGCTTCCCCCCTACCTCCTCTGGTCAGTGCAGGCTCTGGCTCAAATACTGAAGAAACATGTTGGCCAGTTGCGGCAAGTTCTCATTGTTGGGATGCATTTTAGTGTACGAAATAAACTGGCGACGAAGGCGACTCAGTTCTGCCATGGTCAAGGGCCGGGTAAACCGCAAGTGCTCTGTGGTACCAGGAAGCGTGAGCAAGTCCCCGGGGACAGCGCTCTTCTGCGCTTCCATCAATCCGGCCAGTACTTGACTCGTGACCTGGTCCAACTGGTGCAGAAAGCTGCCGGAGGCGAGGGGCTGGGACTGCGTAGACTGATGGGGTGGTGGGGCCCGGTTCTCAAACAGGGCAGAGCGGATCCCCGCCAGGGGCAACGGCTCCTCTAGGCCCACCAAAGTGAATAAAGGCCGGTCCCAGCGATTCCGAGAATCGGGAGCCTCAAAGCGCAGCGTTAGGGCCTCCAGGAGTTCGGGAGAGTAAAAGGCACCGGACCCATGCTTTGCAGATTTCTCTGAATCCGGAGTCACAAGAGCTGGAGACTCCGCAGCCCCGGATTCTTCTCGCTCCAGTTCCTTGGGTACGTCGGCCTGGGCACTTCCATTTACTACAGAGTCCGCAGTATGCAGTTCCCTGAGGACGCTGCTGCCCGCCGCCTGGGCTCTCCCGTCCTCCTCAGCGCGTGGCCGCCAACTCACACTGACGTTCCGGCCAGGGTTCTCGTTCGCGCCCGCCACCTGAGGTCCCGCGATCGGGCCGCCGGGCCGTACGCAGTAGACCAGGCAGAGCGGGGTGCGCGCCGCCCGTGCCAGGCAGTAGAGCTCGTAACGGAAACCTTTGATGTAGTTAAGCGAGTCCAGGATGACCACGTCGTGGCGACTCAGGCGCCGTTCCACGGAGGCTCGCAGAGCTCCACGCAATGCCTTCTCACGGGCAGAATCGCCGTACACCGCTGGGTCCTCTGCGCCCAGGACAGCTGCGTCGTCCACCACGTACACCGCGCGGCCCTCGGCAGCCAGCGCCACGCGCAACTCTTCAGCACGCCGGCTCTTGCCGCTGTACGGCAGCCCGCAAAACACCACGAGCGGCATCCTCTCAGGGAGCGACCATTGGCAACCGCGCTGCGCCAACTTCCGGGTTGTACGCGTCTCCGACGTAAGCCGGAAGTGCAAACTGCTCTTCCTGTCTCCCTTGACTTTTACAGACCCTCTTGTTTCTATGGAAACAGGAGTTCTACGCCAGCTAGGCCCAGGTTCAGCTTTCTCAGAAAGGAGATACAGAGACTATAATGGCATCAGTTATTTATGCCAAATGTTATAGGCCTCAGGAGAATGTGATCTTCCTGCAGCGAAAGACTGCCCGTCCATTTTATTAATAAGGCCTAAGGGGCATTAAATATTGTAAGCAATCAGCACTATATTTAGCATATAGAAGGCAATTAATAAATGCTGGTTCTCCTTCATTCCTCCTCTTAAACCTACTGGCTCTCAGTAAATGTTTATTCAATTACCATTTCAATCATTCAACATCTCCAAGGTTGGGAATTCAGAGATGAACATAAAACGCTTTCCCCACAAAAGATAAAAGGTCTGAATGGGAAGGATCAGGCGCCTACAATCAGAGTAATAAATACTATAATGGATAGATGCAGGTGAGGTTATAAAAGAACAGAAGGGAAAAACAAACTACCCAGAGAAATCACTGAAGACTTTATGTAGAAATAGTCATTTGACTTAGAACTTGAAAGACAAATAGGAATTTTTCTCCTTAGTAGGGTTGCCAGATAAAATA