Transcript asmbl_316142

Sequence
Transcript Sequence for observation asmbl_316142 of TGE0069121:
CCCGGAGTTACTCAAGTGTAACCTAGCATTTGCGCAAGCGCACTTCCCTCCGGAGACGTTAGAAAGTGCATTTTGGCGTCACTTAGGGGACGGTGTAGTGAGTTCCGGCTTCACTGGTTCCAATTCTGTCCCATTGTTCGTTGCATGTGAACTTTTCTGGATTTCAGTTCTTTCATCCGGGGCCTGCCGGTGCCGTAAACGGCCATTCAAAGGGAAAAACGAACACGCACACCAAAGCGCTAGCTTGCGTTCCTGCGCATGCGCAGTGACCCGAGCGGAGAGGCCGAGGCGTAGCCTAAGCGTGGGATTCCGCGCGTGCGCTCGGCTCCGCCTGGTGCGGCCGCGGCCGGGAGGGACTGGATTATGTCGGCCCCGTTTGAGGAGCGGAGTGGGGTGGTACCGTGCGGGACCCCGTGGGGCCAGTGGTACCAGACCTTGGAGGAGGTGTTCATTGAAGTTCAGGTGCCGCCAGGCACGCGCGCCCAGGATATCCAGTGCGGCCTCCAGAGCCGGCATGTGGCGCTGTCGGTGGGCGGCCGCGAGATCCTCAAGGTAGCGGCAGCTCGGGGCTTGTGTTCAGTTTCCTCTTCCCAGACGCCCCCAGCCCCGTTTCCCTGAACGACTGTTGGGTGTCCCGACGGCTCCTGTGGCTGGCAGAAAGAGAAAGAGGATAACACTGACCAGGTTTGGGTCTGGTCAGAGCCCCCGCCTCTTCAGGGCAGGTGCTGAGTTGTGGAAATTTGAGGAGCCTATTTTCGTGTTTAGTTTTCAAACTAAGACTGCTGCTTCTGCTTCTCTGACGGGCTTCAGCTGGGAACAGATTAACTAGGTTGCTAAAGGAACAAATATTTCTTCCGTGCACTGAAGACAGGCAGGAAGACAACAGATAACGTACCTGCAGTGGAGAGGTTAAGCTCCTGTACGGAAGCGTAATTCATAAATAGATAAATATAGGAAAGGACAACAAAGAAAATAGGGATAGAATAACGGGCAGAGAATTTAGAGATGATGTCAGGTGATTAGTTTTCTCATCTAAAAGCTTGAAAATCCTGCATGTTTGTGGAGTGGTCAAGCAGGTGGTGAAGAGGGCAAACTCTTTGATTCTACAATAGCTGATGAGGGAACATGGACTTTGGAGGACAGAAAAATGGTTCGTATTGTTCTTACAAAGACAAAGAGAGATGCAGCAAATTGTTGGACTTCTCTACTAGAATCTGAATATGCAGCGGATCCTTGGGTGCAAGACCAAATGCAGAGAAAGCTTACATTAGAGAGATTCCAAAAAGAAAATCCTGGTTTTGACTTCAGTGGAGCAGAAATCTCAGGAAACTACACTAAAGGTGGACCAGATTTCTCAAACCTTGAGAAATAACTGCTTTTTTTCCTGCATTCTGTGGATCCTAGCAGATATTGCCAACTTAATCAGATAAACAGATTATGTAATGGAAGAAAAATGCGGATGCCTACAGTTAACAGATTGCAAAATGTATCTTAAAATGGTTCTAAAAATTGCATTCAAACATAATTTACATAGGAAATGTACTGTGGGAACTATTCTATGGATATATGGTAAAGTTGTTTTGGACTTGTTTTTGCTCAGCATGAAGTTTTATATGCTGCATTTTACTAATTCCATATTTAACCATATTTTTAATACAAAAGAACATTAGAGTATAGATCATGTGAAATGAAGGGTGCCTTTGGGGAAAATTAACTTTTTCTTTTGATAAGTATGATATTCAATAAAATTTTCTAAATAGGAATTGTGTACCCCTTTGTCTAAGTATAACAATTCACACAAAATTATAGTGCTGAAAACAATTTTAATAAAGGAAAAAGTCCATAAATGTATTTTAAGTAAATTAAGAGTTAATGTAAATTTCTTAATTAGAATATTATTACTTGAGGGATTACTTTATGTCAAGAAGTTTAAAAATAGTTAAAACCCTAACAATAGAAGTGGATTAACACAAAAGAGAAGTGTGATCATGGTAATTAGGTGAGTCCTTTGTGGCAGAAAGCAAAGTAAGGTCACTAATTGTATATCAGTGGCATCATTTTGATTGTAAGTGATTTAGGCATATAGGTAGGAATTGTCTATAGACATTTTATTCAATATCCTATTTATGTCCTTTTTATTTTTTGCCCTTTTTAACTCTTGAAAAAATTTTAAATCTCATGCATAGAAAAGTTACAGATAATTTTTTTCTTTCTGAACCATTTGTGATTTAGTTGAAGACATGATTCCTCATTACTGATTACTATCTGCTTCAAATTATCTTACATGACTACAATGCAACCATTAGAATCAGGAAATTTACGTTGACACATTACTACCCTCTAATCCTCAGATCTTCACTTCATTCACATTGAACTGATTGTCCCAATAATGTCCATATAGCAAGAGGATCCAGTCAGAATCATGCCTTTCATTTAGATGTCAGCTGTCTTTAGTTTACTTCATTCTGGAACAAATTCTCATTTGTTTCCTTTTACAACTTAGTACTTTTGACAATTATGGGCTAGTTTTGTAGAACACCCCTTATTTTGAGTTCTGTCTGATACTTCATGATTAGATTGAGGTTATTCATCTTTGGCAGGAATGTGATAGAAGTGCATCCTGTCATTGTTTAATAATTTCAGTTTGTCTCATTTCTGATGGTGTTTCTTAGATGACTGATTAAGGTAGTGTCTGCCAGACTTCTCCACTGTAGTTATTTTTATAATTATTTCTTGAGAAGATAGTTGCAAAATACTACCTTGTTTCTGATCAGACTTTAAATTTATCGTATCTCTATAAACTCATTATTTTCTATTTTATTCAGCAGGTTAAAAAACCTATTATCATTACATTGGTGCTCAAAATTATTGTACATTTGGCTGGTAGAAGTCCATTCTGGGTGGCCTCTGTGTCCTTCTGACACATTCCCATCATTATTCAATGAATTTGTTACTCTCTGGCATAAGATATACCAGGCTTCTCATGCTGTCCTCGACCTAACCCAAGAATCAGCCATTTTTCCGTAGAGCCTGGGTTCTCTTTAGTGAGTAATATTTAAAAGCCAAGATCTGTGCTAGTGTGCAATTGCCGTTGGTGTGTATATATAATGCATGTCTTTACATCTATATTTCTGCATCTATG