Transcript asmbl_315838

Sequence
Transcript Sequence for observation asmbl_315838 of TGE0002143:
GGGCAGAGAGCCAATGAGAAGTCGCGGCGGACGCCCAGCTTCTCCTCACTCGCACCGGCCCCCTCCCTTCCGCCTGCCGCCTTCCACTCCGCCCCTGGCGGAGGAAGTGATGTCACAGGCCCCATGTGAGCGGATTGCAACACATGCAGCTGCCTGGAGAGAGGGAGCCGGTGTCCTACGTCAGAGCCGCCGCCGCCGCGGAGCCGCCGCCGGGGAGGAGCAGCCGCTGCCGCCCAGGACTGGGCCCTTAGGGAGGAGGAGGCGAGAAGATGGCGGACGACCCCAGTGCTGCCGACAGGAACGTGGAGATCTGGAAGATCAAGAAGCTCATTAAGAGCTTGGAGGCGGCCCGCGGCAATGGCACCAGCATGATATCATTGATCATTCCTCCCAAAGACCAGATTTCACGAGTGGCAAAAATGTTAGCGGATGAGTTTGGAACTGCATCTAACATTAAGTCACGAGTAAACCGCCTTTCAGTCCTGGGAGCCATTACATCTGTACAACAAAGACTCAAACTTTATAACAAAGTACCTCCAAATGGTCTGGTTGTATACTGTGGAACAATTGTAACAGAAGAAGGAAAGGAAAAGAAAGTCAACATTGACTTTGAACCTTTCAAACCAATTAATACGTCATTGTATTTGTGTGACAACAAATTCCATACAGAGGCTCTTACAGCACTACTTTCAGATGATAGCAAGTTTGGATTCATTGTAATAGATGGTAGTGGTGCACTTTTTGGCACACTCCAAGGAAACACAAGAGAAGTCCTGCACAAATTCACTGTGGATCTCCCAAAGAAACACGGTAGAGGAGGTCAGTCAGCCTTGCGTTTTGCCCGTTTAAGAATGGAAAAGCGACATAACTATGTTCGGAAAGTAGCAGAGACTGCTGTGCAGCTGTTTATTTCTGGGGACAAAGTGAATGTGGCTGGTCTAGTTTTAGCTGGATCCGCTGACTTTAAAACTGAACTAAGTCAATCTGATATGTTTGATCAGAGGTTACAATCAAAAGTTTTAAAATTAGTTGATATATCCTATGGTGGTGAAAATGGATTCAACCAAGCTATTGAGTTATCTACTGAAGTCCTCTCCAACGTGAAATTCATTCAAGAGAAGAAATTAATAGGACGATACTTTGATGAAATCAGCCAGGACACGGGCAAGTACTGTTTTGGCGTTGAAGATACACTAAAGGCTTTGGAAATGGGAGCTGTAGAAATTCTAATAGTCTATGAAAATCTGGATATAATGAGATATGTTCTTCATTGCCAAGGCACAGAAGAGGAGAAAATTCTCTATCTAACTCCAGAGCAAGAAAAGGATAAATCTCATTTCACAGACAAAGAGACCGGACAGGAACATGAGCTTATCGAGAGCATGCCCCTGTTGGAATGGTTTGCTAACAACTATAAAAAATTTGGAGCTACGTTGGAAATTGTCACAGATAAATCACAAGAAGGGTCTCAGTTTGTGAAAGGATTTGGTGGAATTGGAGGTATCTTGCGGTACCGAGTAGATTTCCAGGGAATGGAATACCAAGGAGGAGACGATGAATTTTTTGACCTTGATGACTACTAGGTAGTCGACATGGGTCCGGCAAAACGTGCCTCACCCTCCAGCATCCAACCCAAGGAGCATACCCATGGTGGAATCCAAACAGATCCCTGCCTTACAATTGGAACATTTCCAGAACTTAATCCATGAGCATTGGATATTGAAAAGAAAACCGAAACAAAACCAGACCCAGCCCTACACTTTGGTTTGTCATGGTGTCAGCGCAGCAGCCTACAACTAAGTTCCTAAACGCCACTTTGGACTAATTTAAAAAAGAATCCCAGTTTTTACTTTTACTGGATGGTGAAATTGGTTGCTCTTGTATTTTATGAAAAAAAATGATTTTTTTAACCTTCATACATAGAAGCAAAAATACTTTAACTGCTGTAAACCTTCAAAAGTTAATAGAAGTGAGATCATACTGGTTTGTTTCTTATTTTGATTGGAGAAAAATTAAATTGCTGCATTTCGCAGTGACCCATTTACATGGCATTCTCAGCTTAGACTGCGTAAGAAGAAATATATGTGGTGAAATGTTGGAACCATTTCTCTCTTGGTCTCTGTTTAATGTTGAAAGGGTGAGCTAATAGGAGGCACTTTCAACTTCACTCCCTCACGCTACCCCGTCCCCCTCCAGACTGGCAGTTTCAAGGATGCAAATTGCATTGCAAAATCAAACTGACTCATGAAGCATTTGGGCCAGTGCACTGTTTACTTCCATCTGTTTGCAGACACATTTGTGCCCGGCGTTTGGGAGCCCTTTGTATCAATGTTCTGACAAGGGTCCCTATAACCTTAACCTACTCGAAACCGGTTTGGGATGGATATGATGGGGCTTCTGTGCTATTGCTGGGATTGGGAGAAATAAAACATGCAATTTAAGTGGAAGCGAAGAAATTTAAAGAGGATTTTATTTTGCTTGGGTCAATCCTTGTTAAAAGGGAGGTGGATGTGTTTTCCTTGTGTTGGATGGCATGAGATTATGTGAATGTTTTGATTTATTAAAATGAACTGCAAGGTTTTTCACAGGAACGACAGACATGTATGACTGCATGTAATTATAAACTCCTGACCTCCTGGTGGGGTTGGAGCATCTGTTTCAAATGTGGGACTTACAAGCACTTCTCACATGAGAAATTAGGGGCGGGTGGGAAGGGATGGGACACAGCTTCTGGCACCATGGATTTAAGACCATGTTGGATCCAAAAGTTGGCCTGAAACCCTGAAGCTTATGCTTCACAGCTGGGCTGTAAGTCAGACTTGAACCCAGCTGATATGCAAGGTCATGGCGTGCCCAGGGTGGTGACAGTTGAACAAAGTGTATAGTACGTGCCCAGTGGTAGCGATGGAAAAAAGTATACCAAATGGACTTTGAAGGACCAAAGGTTTTAAAAGTCAATTGGTATCACCTCCACACTGACTAGGGTAGTGGGGTGCATTTGGTTTTCAAATTGGGTACTTTTAACACTTTAGTGCCTGACTGCTGTTCTTTACTGACTTGATTCAGTCACTCGTAGCTTTATTGGTCTGAACCAGCTCCTTGTTCCCAGGTTACAGACCTGCCTATCGTTCCAATAATCCTGTTTCACTTGAATGAAGGGAGTATGTCTTAAATGTAAAGTTTCTGGTTCTCACACTGTACTCTGAGGTCCAAATACTGTCTGTCAATGTGTAACCTGATGTCTCAACCCCCTGTGAGAAGAGTCCATTATTTGGTGTTCACCAACGTGGGAGACTTCACCGGAACAGGCTTTTTTGCTTTGGGCTCTGCTATTTGTTTGCAGAACACCCAAGAGCGAGCAAACATGCTCTCTTCACAGCAGTACCTTAGGGTTTTGCCATTGTAAATGGGTCTGATGTGATATGACAAGACCAGAGAAATTGGATGTAAATTTACATTTTTGAATATGCTTGTTGTTTCACATGATACATTTAGGGTATGCAGCTCCTTTTGTAGTTTTTATTTTTACTATTTAAGTTTGGAAATGATGCCAAATTTTTGTATTTCTTTAATCAATGTGTTCTCTTCGGTGATATATATTGCATTATATATTGATGTGTGTATCAATATATATTGATATGTATTACACTTACACATACAAACACATATAAGAGGGGGTGAAAACCGTAGCCTTTGCATTCTCTATAGCCTCTGCAGAGAGATACTAAGCAGCAAAATCTTGGTGTTGTGATGTACAGAAATGGAGAAGAGTATTAAACCATATTTAAGAATA