Transcript asmbl_315354

Sequence
Transcript Sequence for observation asmbl_315354 of TGE0004893:
CATGTTCCTCCGGTCTCCAGCATTCAAAAGAAAAAGGGGGAAAAAAAACCATGCAAATTAGATATCTCTGAATTTCTTGCAAATTAAATAAGACGCAGATTCTGGCTCAGGAAAGTGATGCAAACGCGTCGTTTTCAAAGGAGAGACCCCAGCCTCGGGTCAGGCGCGGCGCAGACAGCGGCGCGGGGTCCTTGGCTGGGCGGGGCTTGCTCGCGGTGGCTTGTGGCTCCTTCCTGCGGTGCTTCTCTCTTTCGCTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCTAGGAAGCTCCGTAGTCACCGACGAGACCAGAAGTGGCATGATAAACAGTATAAGAAAGCTCATTTGGGCACAGCCCTAAAGGCCAACCCTTTTGGAGGTGCTTCTCATGCAAAAGGAATCGTGCTGGAAAAAGTAGGAGTTGAAGCCAAACAGCCAAATTCTGCCATTAGGAAGTGTGTAAGGGTCCAGCTGATCAAGAATGGCAAGAAAATCACAGCCTTTGTACCCAATGACGGTTGCTTGAACTTTATTGAGGAAAATGATGAAGTTCTGGTTGCTGGATTTGGTCGCAAAGGTCATGCTGTTGGTGATATTCCTGGAGTCCGCTTTAAGGTTGTCAAAGTAGCCAATGTTTCTCTTTTGGCCCTATACAAAGGCAAGAAGGAAAGACCAAGATCATAAATATTAATGGTGAAAACACTGTAGTAATAAATTTTCATATGCCAAAAAATGTTTGTATCTTACTGTCCCCTGTTCTCACCACGAAGATCATGTTCATTACCACCACCACCCCCCCTTATTTTTTTTATCCTAAACCAGCAAACGCAGGACCTGTACCAATTTTAGGAGACAATAAGACAGGGTTGTTTCAGGATTCTCTAGAGTTAATAACATTTGTAACCTGGCACAGTTTCCCTCATCCTGTGGAATAAGAAAATGGGATAGATCTGGAATAAATGTGCAGTATTGTAGTATTACTTTAAGAACTTTAAGGGAACTTCAAAAACTCACTGAAATTCTAGTGAGATACTTTCTTTTTTATTCTTGGTATTTTCCATATCGGGTGCAACACTTCAGTTACCAAATTTCATTGCACATAGATTATCTTAGGTACCCTTGGAAATGCACATTCTTGTATCCATCTTACAGGGGCCCAAGATGATAAATAGTAAACTCAAAATTGCTCCCCACTCTGTTTATTATTTAAAGGTGTCAGGATCTGTGTTGTAATGTGTCTACATTAATGTGTTTAGGAGAATACAGGCATTGGATCATTTAGTTGATGGAAGTATATGCCAGGCAAGGGAGATAAGGTATACGACAAGACTGATGTTTTCAGTATCTTCTCATGAGGTTGTCAGAGACCTTCATGTCTTCAAAGACTAGTCAGCAAATGAAGTGGTTTAGTGTAGAGACAAGATTGGTTGTGTTTTGATAATTTAAGCTAGGTATTGAGTACATGTGGATTTTGCTGTCCACAAATACTTGTTTCAGAGTTTTCATGGATACAGTGGCATGGTTGAAATGAAGCTGTGAGCCTTCTGCTTTAAATCTGATGTAAGAAACTCCTGTTAACAAATAGTAAGTATGGGTTAATTAGCCCTTTGATCAAAGCCTAGCTTTACATTGTTTAGGATCTTTGGAAAACAATTGGTTTGGTTGCCCACTTTCCGTAGGATCAAGAGCAGAACCTTTCACATGGCACAGAAGAACCCAGGTTGCGCTTCATACCTGCATATTCCAGCCTTAGCCTGCCATTTCTCTCCTTGGCACTTTGTGCTCCAGCAACACTGGTCTCAGTTGGTCATCCTCAAACTTGGGTTCCATATCCAGCCTCAGGACCTCTGTTCCTGTTACTATGGTTCCTTGCATGTCGCCTGCTCTTACTAAAGAGCTCGTGTGTTTTCCAGCACACTTCGGTTTATCTCTTGATGATGATGCTAGTCTCTCCCTCCGCAAGGGCGGAAAGGCTGCCTGTTGGTTTGTACCAGTGTTTCCTAACGTGTAGCTGCAGTCAGTATTTGGCTAAGCTGTTCCCAGGGGCTCAACAGATGCTTTCGGATGAGCCTTAACTGACCCAATCCTTTGTGATGCGGGAGAGATTGCTAGGCCTCGCTCACCTGGCCAGAACCAGGGAAAGAGGCCGCGGTTGCAGCGCGATTCCAGGCCCTGGGCGTCAGGCGCGGGGTGGGCAGCTCTCCCCGGGCGGTGGGGCCCTTGTGACCGCGAGGCGGGGCGCACCAGGAAGGGAGTGGGACAGCGCGGGCGCCCAGGGATGTGGCCTGGTTACCTGCCTTCTCTGATACGTCAAGACACCTTCAACAATGGCTTGCAGCTGTACCCTGTTGGCTGCACCCAGGACGCCCTTTTCACTGCTAAGCAGTCCTACCTGAGGCCCAGGGGCTGCCAGATTGACCCATAAATAATCTCCGGCGCCTCAGATCCAGAAGCTGCTGAGCCTGATCTTAGTGCCTTCTCCTTTCTCTGTGTGGCCCCCCAGCCCCTTTCCCCACTGCCTTGTGTCCAAGGCCCTTTCCTTCATGTATCCATGGAGGAGAGACAAAAATACACATCAATAAAATAAGATAGGGAATCCATAAATAGACATTCAGAAGTATGGCCAACGGATTTATCTTAAAACCAATGGAGGAAGAAGAGTTTCAATAAATGTTGTGGACTTCCATTTGTCAAAGACCAAAACAAAGGAACCCCAACCTTACATGTAATACAAACTTAACTCAAAATGGATCATATATCTAAATGTAAAATGGAAAGCTATAAAACTGAAAACAGACTATCTTTACAACCTAGGCGTAGGTATAGTTTTTAGACATTACACCAAAAGCACATGCCGTAAAAGAAAAAATAGATAAATTGGTGGATTTCATTAAAATTAAAAAACTTTTTCTCTCTGAAAAATCCTGTTAAGCTGGGCGCTGTGGTTCATGCCTGTAATCCCAGCACTT