Transcript asmbl_277770

Sequence
Transcript Sequence for observation asmbl_277770 of TGE0007602:
GGCCTTCTGAAATATGAGAAAATGTTACCCTGATAGTCTCGATGATATTTTGCACCATGGGTAGGGTTGTATTTTAAAGTTAAATGACTACATATATTGTTTTTTGTTTTTGTCGAGAGACCTGAGATGGGGCTAATTGAAAACGTCTGGAGCTTAAAGACCCGTGCAGTTTACGCAGCAAGGATATTATTGCTCTGAATTTCAATAAATCAACATTTCACTATATATCGGCAAAGTCTACAGCCTTTAAAAAATGACCAATATAGACGGAATCAAAACCGATGTAGTCCCAAAGCGGCACAGAGCTGTATCTGCCAAAGCGTCCATTTAAATTCGTGCGTTCCAAGGAAAATTACTGCTTAGTTTCTATCCATTTGCAAAAGTTTATGATTTTTTTCAGGCATTCCTCACACCTGTTAGGTTAAAATCAGTAACACTCTTAAAAAGAAAGCGAGAGACCGGAAATGATATGAGAATAGAATTGGCCACTCCAGAGACATCTGCAAATGACACTCCATTTTTCCTTCTCGCGCTGCAAAATGTACCGGTAAACCGGACTTCCCGGGACTCGCTGGGTGGCCGACATTTTCCCTAGCAGGAATTTTACGTTTCCAAGATCTGAATGGATGTTAACGGTCGGGCTAAATGCCAGGCAGGTCTTCATTGTGGAATTAAACAGCGGTGGGAGCAAGCGGAATAACCGAGTTCCCCTCCCGCACCTGAGTGCCGGCAGCGAGCCGCGAGCCGGGACCTGTCACCCGCGGGAAGCCCCGGCCGCCCGACGAACAGCATCTCCGGTTTCCGCCTCCGGCTCCGGCGCGGCTCCCCCGGCCCGCCTCTGCGTCAGGGACGCGGAAACCCCGTAGGAGCAGGGCGGGCGGGGAAAGCGAGGTTTAACTAACTCCGCAGCTATATTCTTCCGCCGCGAGGTAAAGAGTCCCAACCCAACCCCGGGCCCTAGGATTTCCAGCGACCCTGTAATATCGAGAAATTACCACATTTGGGTTTTTCTACCAACTTGCTTAGGATTTTATCCGAGGTAACGACCCCAGGATCACAATTTTGTAGCTGACCGAAGCACGGCGAGAAAATTCCTCCGCAAGAAACGGGTTCCGGCCACGAGCCTATAAAAAACGGGTGGTTGGGCGCCGCTGTCTTTTCAGTCGGGCGCTGAGTGGTTTTTCGGATCATGTCTGGTGGCTCCGCGGATTATAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGAGCAACTGGAATGAGATTGTTGATAACTTTGATGATATGAATTTAAAGGAGTCTCTCCTTCGTGGCATCTATGCTTACGGTTTTGAGAAGCCTTCCGCTATTCAGCAGAGAGCTATTATTCCCTGTATTAAAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGATCCAAAAGGTAATTCTGGCACTTGGAGACTATATGGGAGCCACTTGTCATGCCTGCATTGGTGGAACAAATGTTCGAAATGAAATGCAAAAACTGCAGGCTGAAGCACCACATATTGTTGTTGGTACACCCGGGAGAGTGTTTGATATGTTAAACAGAAGATACCTTTCTCCAAAATGGATCAAAATGTTTGTTTTGGATGAAGCAGATGAAATGTTGAGCCGTGGTTTTAAGGATCAAATCTATGAGATTTTCCAAAAACTAAACACAAGTATTCAGGTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTGTTGGAAGTGACCAAAAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAAAAGGAAGAATTGACCCTTGAAGGAATCAAACAGTTTTATATTAATGTTGAGAGAGAGGAATGGAAGTTGGATACACTTTGTGACTTGTACGAGACACTGACCATTACACAGGCTGTTATTTTTCTCAATACGAGGCGCAAGGTGGACTGGCTGACTGAGAAGATGCATGCCAGAGACTTCACAGTTTCTGCTCTGCATGGTGACATGGACCAGAAGGAGAGAGATGTTATCATGAGGGAATTCCGGTCAGGGTCAAGTCGTGTTCTGATCACTACTGACTTGTTGGCTCGCGGGATTGATGTGCAACAAGTGTCTTTGGTTATAAATTATGATCTACCTACCAATCGTGAAAACTATATTCACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAGATGCCCATGAATGTGGCTGACCTTATTTAATTCCTGGGATGAGAGTTTTGGATGCAGTGCTCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCTTTCTTTGGGAATATTTGAATCTTGTCTCAATGCTCATAACGGATCAGAAATACAGATTTTGATAGCAAAGCGACGTTAGTCGTGAGCTCTTGTGAGGAAAGTCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGTGGGTATAAAAGATGGGGTCTGTAAAATCTTTCTTTCTTAGAAATTTATTTCCTAGTTCTGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTAGCATATCTGCCTTTATTGTGTTTGTCATTAGCCTGAGTAGAAAGGCCTTTAAAATTTTTTTAGAAAGCATTTGAATGCATTTTGTTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCCCAGCAAGCAATCCTAGGTAGGGTTTAATCCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAATTGTATATTCACTTTAAA