Transcript asmbl_277161

Sequence
Transcript Sequence for observation asmbl_277161 of TGE0001880:
GGCGTCGAGCGTCTCGTGACAGGTACTTCCGCTCGGGGCGGCGGCGGTGGCGGAAGTGGGAGCGGGCCTGGAGTCTTGGCCATAAAGCCTGAGGCGGCGGCAGCGGCGGAGTTGGCGGCTTGGAGAGCTCGGGAGAGTTCCCTGGAACCAGAACTTGGACCTTCTCGCTTCTGTCCTCCGTTTAGTCTCCTCCTCGGCGGGAGCCCTCGCGACGCGCCCGGCCCGGAGCCCCCAGCGCAGCGGCCGCGTTTGAAGGATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTTATCATCCTGGGAGATTCTGGAGTCGGGAAGACATCACTCATGAACCAGTATGTGAATAAGAAATTCAGCAATCAGTACAAAGCCACAATAGGAGCTGACTTTCTGACCAAGGAGGTGATGGTGGATGACAGGCTAGTCACAATGCAGATATGGGACACAGCAGGACAGGAACGGTTCCAGTCTCTCGGTGTGGCCTTCTACAGAGGTGCAGACTGCTGCGTTCTGGTATTTGATGTGACTGCCCCCAACACATTCAAAACCCTAGATAGCTGGAGAGATGAGTTTCTCATCCAGGCCAGTCCCCGAGATCCTGAAAACTTCCCATTTGTTGTGTTGGGAAACAAGATTGACCTCGAAAACAGACAAGTGGCCACAAAGCGGGCACAGGCCTGGTGCTACAGCAAAAACAACATTCCCTACTTTGAGACCAGTGCCAAGGAGGCCATCAACGTGGAGCAGGCGTTCCAGACGATTGCACGGAATGCACTTAAGCAGGAAACGGAGGTGGAGCTGTACAACGAATTTCCTGAACCTATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCGGCAGAAAGCTGCAGTTGCTGAGGGGGCAGTGAGAGTTGAGCACAGAGTCCTTCACAAACCAAGAACACACGTAGGCCTTCAACACAATTCCCCTCTCCTCTTCCAAACAAAACATACATTGATCTCTCACATCCAGCTGCCAAAAGAAAACCCCATCAAACACAGTTACACCCCACATATCTCTCACACACACACACACACGCACACACACACACACAGATCTGACGTAATCAAACTCCAGCCCTTGCCCGTGATGGCTCCTTGGGGTCTGCCTGCCCACCCACATGAGCCCGCGAGTATGGCAGCAGGACAAGCCAGCGGTGGAAGTCATTCTGATATGGAGTTGGCATTGGAAGCTTATTCTTTTTGTTCACTGGAGAGAGAGAGAACTGTTTACAGTTAATCTGTGTCTAATTATCTGATTTTTTTTATTGGTCTTGTGGTCTTTTTACCCCCCCTTTCCCCTCCCTCCTTGAAGGCTACCCCTTGGGAAGGCTGGTGCCCCATGCCCCATTACAGGCTCACACCCAGTCTGATCAGGCTGAGTTTTGTATGTATCTATCTGTTAATGCTTGTTACTTTTAACTAATCAGATCTTTTTACAGTATCCATTTATTATGTAATGCTTCTTAGAAAAGAATCTTATAGTACATGTTAATATATGCAACCAATTAAAATGTATAAATTAGTGTAAGAAATTCTTGGATTATGTGTTTAAGTCCTGTAATGCAGGCCTGTAAGGTGGAGGGTTGAACCCTGTTTGGATTGCAGAGTGTTACTCAGAATTGGGAAATCCAGCTAGCGGCAGTATTCTGTACAGTAGACACAAGAATTATGTACGCCTTTTATCAAAGACTTAAGAGCCAAAAAGCTTTTCATCTCTCCAGGGGGAAAACTGTCTAGTTCCCTTCTGTGTCTAAATTTTCCAAAACGTTGATTTGCATAATACAGTGGTATGTGCAATGGATAAATTGCCGTTATTTCAAAAATTAAAATTCTCATTTTCTTTCTTTTTTTTCCCCCCTGCTCCACACTTCAAAACTCCCGTTAGATCAGCATTCTACTACAAGAGTGAAAGGAAAACCCTAACAGATCTGTCCTAGTGATTTTACCTTTGTTCTAGAAGGCGCTCCTTTCAGGGTTGTGGTATTCTTAGGTTAGCGGAGCTTTTTCCTCTTTTCCCCACCCATCTCCCCAATATTGCCCATTATTAATTAACCTCTTTCTTTGGTTGGAACCCTGGCAGTTCTGCTCCCTTCCTAGGATCTGCCCCTGCATTGTAGCTTGCTTAACGGAGCACTTCTCCTTTTTCCAAAGGTCTACATTCTAGGGTGTGGGCTGAGTTCTTCTGTAAAGAGATGAACGCAATGCCAATAAAATTGAACAAGAACAATGATCATCTGCCTTTGCCAGAGTCTTTTTTTCCTTCTTCAAGAGCCTTGGCTCAGTAGAGACCACATGAGCTAATCATAG