Transcript asmbl_48960

Sequence
Transcript Sequence for observation asmbl_48960 of TGE0005904:
CGGCGTGGGCCGGAAGTGGGCGGGCAGCGGCGGCGCGCGGAGGAGGTGGAGGAGGTGCCGGGCGGCCGCTTCCCGCCCCCGAGCGCGAGCCGGTTCCGAGCGGAGTGGAGCGGAGGTCGGACCCGGAGCGGAGCCGGCTGAGCGGGCGCTGAGCCCCCGCCATGGCCCGGAACACGCTGTCCTCGCGCTTCCGTCGGGTGGACATCGACGAGTTTGACGAGAACAAATTTGTGGACGAGCAGGAGGAGGCGGCGGCGGCGGCGGGCGAGCCAGGCCCGGACCCCAGCGAGGTGGATGGGCTCCTGCGGCAAGGGGACATGCTTCGGGCGTTTCACGCAGCCTTGAGGAACTCTCCTGTCAACACCAAGAATCAAGCCGTGAAGGAACGAGCCCAGGGCGTGGTGCTGAAAGTGCTTACAAATTTTAAGAGCAGCGAAATTGAGCAGGCTGTGCAGTCACTGGACAGAAATGGCATTGACTTGCTAATGAAGTACATTTATAAAGGGTTTGAGAAGCCCACAGAAAATAGCAGCGCAGTGTTACTCCAGTGGCATGAAAAGGCGTTAGCAGTAGGAGGACTAGGCTCCATTATAAGAGTTCTTACAGCAAGAAAGACTGTTT