Transcript asmbl_275696

Sequence
Transcript Sequence for observation asmbl_275696 of TGE0005218:
GACCCCTTTGCTGATGCAACTAAGGGTGACGACTTACTCCCGGCAGGGACTGAGGATTACATTCATATAAGAATCCAGCAACGGAACGGCAGAAAGACACTGACTACTGTTCAGGGCATTGCAGATGATTATGACAAAAAGAAACTTGTGAAAGCTTTCAAAAAGAAATTTGCCTGTAATGGTACTGTGATTGAACATCCTGAATACGGAGAGGTTATTCAGCTTCAAGGTGACCAAAGAAAAAACATCTGCCAGTTTCTCTTGGAGGTTGGCATTGTAAAGGAGGAACAGCTTAAGGTTCATGGATTCTAAAATGAACCTAAATACGTGGAGAATTTCTTGAATAGTTTTGTTCTCTAAACCCGGTTTGGCTGCCTTGTGAAATGATTCCCTGCAGTAAACGGACTTTTCATTTATTTAATCATTCAAACTTCCATTCACATCTGCATGATTACAGAAAACATGGGGTATGTAGACTAGTAACACATAAGAAAATTGCAGTAAGATGGTAACAAAACCTCATATTGTCTTTACATGTTTCCAATGGAAAATGTTTTGAGTGTTTATTGTTCAGTTTATTACGTTTCACTTGATTAAATTTTTTTGTTGTTGTATTAAACCATGTACGTTGCAGCTTAACAATAAAAAAAAATCTATGAATCTTTGTGAGCAATTATGCTCCCAAATCTAAGCAAGTAAAATACACATTTTGTCTTTCTTAA