Transcript asmbl_11416

Sequence
Transcript Sequence for observation asmbl_11416 of TGE0000106:
GTTGCATCAGATTCTAGGAAGTGTCTGTAGCCGCAGCTGCGGGTCCGGGATTCCCAGCCATGGCAGATTCCTCCGGGCAGCAGGGCAAAGGCCGGCGTGTGCAGCCCCAGTGGTCCCCTCCTGCTGGGACCCAGCCATGCAGACTCCACCTTTACAACAGCCTCACCAGGAACAAGGAAGTGTTCATACCTCAAGATGGGAAAAAGGTGACGTGGTATTGCTGTGGGCCAACCGTCTATGACGCATCTCACATGGGGCACGCCAGGTCCTACATCTCTTTTGATATCTTGAGAAGAGTGTTGAAGGATTACTTCAAATTTGATGTCTTTTATTGCATGAACATTACGGATATTGATGACAAGATCATCAAGAGGGCCCGGCAGAACCACCTGTTCGAGCAGTATCGGGAGAAGAGGCCTGAAGCGGCACAGCTCTTGGAGGATGTTCAGGCCGCCCTGAAGCCATTTTCAGTAAAATTAAATGAGACCACGGATCCCGATAAAAAGCAGATGCTCGAACGGATTCAGCACGCAGTGCAGCTTGCCACAGAGCCACTTGAGAAAGCTGTGCAGTCCAGACTCACGGGAGAGGAAGTCAACAGCTGTGTGGAGGTGTTGCTGGAAGAAGCCAAGGATTTGCTCTCTGACTGGCTGGATTCTACACTTGGCTGTGATGTCACTGACAATTCCATCTTCTCCAAGCTGCCCAAGTTCTGGGAGGGGGACTTCCACAGAGACATGGAAGCTCTGAATGTTCTCCCTCCAGATGTCTTAACCCGGGTTAGTGAGTATGTGCCAGAAATTGTGAACTTTGTCCAGAAGATTGTGGACAACGGTTACGGCTATGTCTCCAATGGGTCTGTCTACTTTGATACAGCGAAGTTTGCTTCTAGCGAGAAGCACTCCTATGGGAAGCTGGTGCCTGAGGCCGTTGGAGATCAGAAAGCCCTTCAAGAAGGGGAAGGTGACCTGAGCATCTCTGCAGACCGCCTGAGTGAGAAGCGCTCTCCCAACGACTTTGCCTTATGGAAGGCCTCTAAGCCCGGAGAACCGTCCTGGCCGTGCCCTTGGGGAAAGGGTCGTCCGGGCTGGCATATCGAGTGCTCGGCCATGGCAGGCACCCTCCTAGGGGCTTCGATGGACATTCACGGAGGTGGGTTCGACCTCCGGTTCCCCCACCATGACAATGAGCTGGCACAGTCGGAGGCCTACTTTGAAAACGACTGCTGGGTCAGGTACTTCCTGCACACAGGCCACCTGACCATTGCAGGCTGCAAAATGTCAAAGTCACTAAAAAACTTCATCACCATTAAAGATGCCTTGAAAAAGCACTCAGCACGGCAGTTGCGGCTGGCCTTCCTCATGCACTCGTGGAAGGACACCCTGGACTACTCCAGCAACACCATGGAGTCAGCGC