Transcript asmbl_274692

Sequence
Transcript Sequence for observation asmbl_274692 of TGE0001787:
GCCGGGGGCGGGGCCAGGCTATAAACCGCCGGTTAGGGGCCGCCATCCCCTCAGAGCGTCGGGATATCGGGTGGCGGCTCGGGACGGAGGACGCGCTAGTGTTCTTCTGTGTGGCAGTTCAGAATGATGGATCAAGCTAGATCAGCATTCTCTAACTTGTTTGGTGGAGAACCATTGTCATATACCCGGTTCAGCCTGGCTCGGCAAGTAGATGGCGATAACAGTCATGTGGAGATGAAACTTGCTGTAGATGAAGAAGAAAATGCTGACAATAACACAAAGGCCAATGTCACAAAACCAAAAAGGTGTAGTGGAAGTATCTGCTATGGGACTATTGCTGTGATCGTCTTTTTCTTGATTGGATTTATGATTGGCTACTTGGGCTATTGTAAAGGGGTAGAACCAAAAACTGAGTGTGAGAGACTGGCAGGAACCGAGTCTCCAGTGAGGGAGGAGCCAGGAGAGGACTTCCCTGCAGCACGTCGCTTATATTGGGATGACCTGAAGAGAAAGTTGTCGGAGAAACTGGACAGCACAGACTTCACCGGCACCATCAAGCTGCTGAATGAAAATTCATATGTCCCTCGTGAGGCTGGATCTCAAAAAGATGAAAATCTTGCGTTGTATGTTGAAAATCAATTTCGTGAATTTAAACTCAGCAAAGTCTGGCGTGATCAACATTTTGTTAAGATTCAGGTCAAAGACAGCGCTCAAAACTCGGTGATCATAGTTGATAAGAACGGTAGACTTGTTTACCTGGTGGAGAATCCTGGGGGTTATGTGGCGTATAGTAAGGCTGCAACAGTTACTGGTAAACTGGTCCATGCTAATTTTGGTACTAAAAAAGATTTTGAGGATTTATACACTCCTGTGAATGGATCTATAGTGATTGTCAGAGCAGGGAAAATCACCTTTGCAGAAAAGGTTGCAAATGCTGAAAGCTTAAATGCAATTGGTGTGTTGATATACATGGACCAGACTAAATTTCCCATTGTTAACGCAGAACTTTCATTCTTTGGACATGCTCATCTGGGGACAGGTGACCCTTACACACCTGGATTCCCTTCCTTCAATCACACTCAGTTTCCACCATCTCGGTCATCAGGATTGCCTAATATACCTGTCCAGACAATCTCCAGAGCTGCTGCAGAAAAGCTGTTTGGGAATATGGAAGGAGACTGTCCCTCTGACTGGAAAACAGACTCTACATGTAGGATGGTAACCTCAGAAAGCAAGAATGTGAAGCTCACTGTGAGCAATGTGCTGAAAGAGATAAAAATTCTTAACATCTTTGGAGTTATTAAAGGCTTTGTAGAACCAGATCACTATGTTGTAGTTGGGGCCCAGAGAGATGCATGGGGCCCTGGAGCTGCAAAATCCGGTGTAGGCACAGCTCTCCTATTGAAACTTGCCCAGATGTTCTCAGATATGGTCTTAAAAGATGGGTTTCAGCCCAGCAGAAGCATTATCTTTGCCAGTTGGAGTGCTGGAGACTTTGGATCGGTTGGTGCCACTGAATGGCTAGAGGGATACCTTTCGTCCCTGCATTTAAAGGCTTTCACTTATATTAATCTGGATAAAGCGGTTCTTGGTACCAGCAACTTCAAGGTTTCTGCCAGCCCACTGTTGTATACGCTTATTGAGAAAACAATGCAAAATGTGAAGCATCCGGTTACTGGGCAATTTCTATATCAGGACAGCAACTGGGCCAGCAAAGTTGAGAAACTCACTTTAGACAATGCTGCTTTCCCTTTCCTTGCATATTCTGGAATCCCAGCAGTTTCTTTCTGTTTTTGCGAGGACACAGATTATCCTTATTTGGGTACCACCATGGACACCTATAAGGAACTGATTGAGAGGATTCCTGAGTTGAACAAAGTGGCACGAGCAGCTGCAGAGGTCGCTGGTCAGTTCGTGATTAAACTAACCCATGATGTTGAATTGAACCTGGACTATGAGAGGTACAACAGCCAACTGCTTTCATTTGTGAGGGATCTGAACCAATACAGAGCAGACATAAAGGAAATGGGCCTGAGTTTACAGTGGCTGTATTCTGCTCGTGGAGACTTCTTCCGTGCTACTTCCAGACTAACAACAGATTTCGGGAATGCTGAGAAAACAGACAGATTTGTCATGAAGAAACTCAATGATCGTGTCATGAGAGTGGAGTATCACTTCCTCTCTCCCTACGTATCTCCAAAAGAGTCTCCTTTCCGACATGTCTTCTGGGGCTCCGGCTCTCACACGCTGCCAGCTTTACTGGAGAACTTGAAACTGCGTAAACAAAATAACGGTGCTTTTAATGAAACGCTGTTCAGAAACCAGTTGGCTCTAGCTACTTGGACTATTCAGGGAGCTGCAAATGCCCTCTCTGGTGACGTTTGGGACATTGACAATGAGTTTTAAATGTGATACCCATAGCTTCCATGAGAACAGCAGGGTAGTCTGGTTTCTAGACTTGTGCTGATCGTGCTAAATTTTCAGTAGGGCTACAAAACCTGATGTTAAAATTCCATCCCATCATCTTGGTACTACTAGATGTCTTTAGGCAGCAGCTTTTAATACAGGGTAGATAACCTGTACTTCAAGTTAAAGTGAATAACCACTTAAAAAATGTCCATGATGGAATATTCCCCTATCTCTAGAATTTTAAGTGCTTTGTAATGGGAACTGCCTCTTTCCTGTTGTTGTTAATGAAAATGTCAGAAACCAGTTATGTGAATGATCTCTCTGAATCCTAAGGGCTGGTCTCTGCTGAAGGTTGTAAGTGGTCGCTTACTTTGAGTGATCCTCCAACTTCATTTGATGCTAAATAGGAGATACCAGGTTGAAAGACCTTCTCCAAATGAGATCTAAGCCTTTCCATAAGGAATGTAGCTGGTTTCCTCATTCCTGAAAGAAACAGTTAACTTTCAGAAGAGATGGGCTTGTTTTCTTGCCAATGAGGTCTGAAATGGAGGTCCTTCTGCTGGATAAAATGAGGTTCAACTGTTGATTGCAGGAATAAGGCCTTAATATGTTAACCTCAGTGTCATTTATGAAAAGAGGGGACCAGAAGCCAAAGACTTAGTATATTTTCTTTTCCTCTGTCCCTTCCCCCATAAGCCTCCATTTAGTTCTTTGTTATTTTTGTTTCTTCCAAAGCACATTGAAAGAGAACCAGTTTCAGGTGTTTAGTTGCAGACTCAGTTTGTCAGACTTTAAAGAATAATATGCTGCCAAATTTTGGCCAAAGTGTTAATCTTAGGGGAGAGCTTTCTGTCCTTTTGGCACTGAGATATTTATTGTTTATTTATCAGTGACAGAGTTCACTATAAATGGTGTTTTTTTAATAGAATATAATTATCGGAAGCAGTGCCTTCCATAATTATGACAGTTATACTGTCGGTTTTTTTTAAATAAAAGCAGCATCTGCTAATAAAACCCAACAGATACTGGAAGTTTTGCATTTATGGTCAACACTTAAGGGTTTTAGAAAACAGCCGTCAGCCAAATGTAATTGAATAAAGTTGAAGCTAAGATTTAGAGATGAATTAAATTTAATTAGGGGTTGCTAAGAAGCGAGCACTGACCAGATAAGAATGCTGGTTTTCCTAAATGCAGTGAATTGTGACCAAGTTATAAATCAATGTCACTTAAAGGCTGTGGTAGTACTCCTGCAAAATTTTATAGCTCAGTTTATCCAAGGTGTAACTCTAATTCCCATTTTGCAAAATTTCCAGTACCTTTGTCACAATCCTAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAAAGAACAAGGTAGTTTTTACCTACCACAGTGTCTGTATCGGAGACAGTGATCTCCATATGTTACACTAAGGGTGTAAGTAATTATCGGGAACAGTGTTTCCCATAATTTTCTTCATGCAATGACATCTTCAAAGCTTGAAGATCGTTAGTATCTAACATGTATCCCAACTCCTATAATTCCCTATCTTTTAGTTTTAGTTGCAGAAACATTTTGTGGTCATTAAGCATTGGGTGGGTAAATTCAACCACTGTAAAATGAAATTACTACAAAATTTGAAATTTAGCTTGGGTTTTTGTTACCTTTATGGTTTCTCCAGGTCCTCTACTTAATGAGATAGTAGCATACATTTATAATGTTTGCTATTGACAAGTCATTTTAACTTTATCACATTATTTGCATGTTACCTCCTATAAACTTAGTGCGGACAAGTTTTAATCCAGAATTGACCTTTTGACTTAAAGCAGAGGGACTTTGTATAGAAGGTTTGGGGGCTGTGGGGAAGGAGAGTCCCCTGAAGGTCTGACACGTCTGCCTACCCATTCGTGGTGATCAATTAAATGTAGGTATGAATAAGTTCGAAGCTCCGTGAGTGAACCATCATTATAAACGTGATGATCAGCTGTTTGTCATAGGGCAGTTGGAAACGGCCTCCTAGGGAAAAGTTCATAGGGTCTCTTCAGGTTCTTAGTGTCACTTACCTAGATTTACAGCCTCACTTGAATGTGTCACTACTCACAGTCTCTTTAATCTTCAGTTTTATCTTTAATCTCCTCTTTTATCTTGGACTGACATTTAGCGTAGCTAAGTGAAAAGGTCATAGCTGAGATTCCTGGTTCGGGTGTTACGCACACGTACTTAAATGAAAGCATGTGGCATGTTCATCGTATAACACAATATGAATACAGGGCATGCATTTTGCAGCAGTGAGTCTCTTCAGAAAACCCTTTTCTACAGTTAGGGTTGAGTTACTTCCTATCAAGCCAGTACGTGCTAACAGGCTCAATATTCCTGAATGAAATATCAGACTAGTGACAAGCTCCTGGTCTTGAGATGTCTTCTCGTTAAGGAGATGGGCCTTTTGGAGGTAAAGGATAAAATGAATGAGTTCTGTCATGATTCACTATTCTAGAACTTGCATGACCTTTACTGTGTTAGCTCTTTGAATGTTCTTGAAATTTTAGACTTTCTTTGTAAACAAATGATATGTCCTTATCATTGTATAAAAGCTGTTATGTGCAACAGTGTGGAGATTCCTTGTCTGATTTAATAAAATACT