Transcript asmbl_48713

Sequence
Transcript Sequence for observation asmbl_48713 of TGE0005877:
CAGAGAAAACTAGGAAGATCCTGACGGAGTTCCTTCGTTTTTACGAGGACCAGTATGGTGTCGCCCTTTTCAACAGCATGCGCCACGAAATCGAGGGCACCGGGGTGCCGCAGGCCCAGCTGCTCTGGCGCAAGGTGCCGCTGGATGAGCGCATCATCTTCTCGGGGAACCTCTTCCAGCACCAGGAGGACAACAAGAAGTGGAGGAACCGCTTCAGCCTCGTGCCCCACAACTATGGGCTGGTTCTCTACGAGAACAAAGTGGCGTATGAGCGGCAGGTCCCACCCCGAGCTGTCATCAACAGCGCAGGCTACAAAATCCTCACATCCGTGGACCAGTACCTGGAGCTCGTTGGCAACTCCTTACCAGGGACCACCTCGAAATCGGGCTCCGCCCCCATCCTCAAGTGCCCCACGCAGTTCCCACTCATCCTCTGGCATCCTTCTGCACGACACTACTACTTCTGCATGATGACAGAAGCCGAGCAGGACAAGTGGCAGGCTGTCCTGCAGGACTGCATCCGGCACTGCAACAACGGGATCCCCGAGGACTCCAAGGTGGAGGGCCCTGCGTTCACGGACGCCATTCGCATGTACCGCCAGTCGAAGGAGCTGTATGGCACCTGGGAGATGCTGTGTGGCAACGAGGTGCAGATCCTGAGCAACCTGGTGATGGAGGAGCTGGGCCCTGAGCTGAAGGCGGAACTTGGCCCCCGGCTGAAGGGGAAACCACAGGAGCGGCAGCGGCAGTGGATCCAGATCTCGGATGCTGTGTACCGCATGGTGTACGAGCAGGCCGCAGCGCAGTTTGAGGCGGTGCTGTCCAAGCTGCAGCTGGCCCGGCCGGCCATGGAGGCGGTCATCCGCACCGACATGGACCAGATCATCACCTCCAAGGAGCATCTGGCCAGCAAGATCCGAGCCTTCATTCTCCCCAAGGCGGAGGTGTGTGTCCGGAACCACGTTCAGCCCTACATCCCGTCCATCCTGGAGGCCCTCATGGTGCCCACCAGCCAGGGCTTCACGGAGGTGCGGGACGTCTTCTTCAAGGAGGTCACCGACATAAACCTGAACATCATCAATGAGGGCGGCATCGACAAGCTGGGCGAGTACATGGAGAAGCTGTCCCAGCTGGCGTACCACCCCCTCAAGATGCAGAGCTGCTACGAGAAGATGGAGCCGCTGCGGCTTGATGGTCTGCAGCAGCGTTTCGACGTGTCCAGCACGTCCGTGTTCAAGCAGCGAGCCCAGATCCATATGCGTGAGCAAATGGACAATGCCGTGTACACCTTCGAGACCCTCCTGCACCAGGAGCTGGGGAAGGGGCCCACCAAGGAGGAGCTGTGCAAGTCCATCCAGAGGATCCTGGAGCGGGTGCTGAAGAAATATGACTATGACAGCAGCTCTGTGCGGAAGCGCTTCTTCCGAGAGGCATTGCTGCAGATCACGATCCCATTCTTGCTCAAGAAGCTGGCCCCCACCTGCAAGTCGGAGCTGCCCCGGTTCCAGGAGCTGATCTTCGAGGACTTCGCCAGGTTCATCCTGGTGGAGAACACGTACGAGGAGGTGGTGCTGCAGACGGTCATGAAGGACATCCTGCAGGCCGTGAAGGAGGCCGCTGTGCAGAGGAAGCACAACCTGTACCGGGACAGCATGGTCATGCACAACAGCGACCCCAACCTGCACCTGCTGGCCGAAGGCACGCCCATTGACTGGGGTGAGGAGTATGGCGATGGTGGTGGCAGTGGCGGCAGCAGTGGGAACAGCGGTGATCCCAGCCCCAGTGTCCCAGAAGCAGCCACCACCTCAGAGAAACAACGGCGTGCCAAGCAGGTGGTGTCCATGGTCCATGACGAGGCAGGGCTGCCCTTTGAGGCTGGCCCTGAGCTACTATCACCTGCATCCCTGGACAGTGTCACCGAGCTCCGTGGCCTGCTGGCCCAGGATCTGCGGGCTGAGAGCCCCCCGCCGGCCGGACCCCTGCTCAACGGGGCCCCTCTGCGGGAGAGCTCCCAGCCTGTGGCCACCCCCGAGGCCTCACCACCTGCCTCGCCCCTCCGGCAGCTCCCGCCTGGAAAGGCTGTGGACCTTGAACCTCCCAAGCCCAGTGACCAGGAGACCGGGGAGCAGGTGTCTAGCCCTGGTGGCCGCCCTGCCATCCACACTACCACCGAGGACAGTGCGGGGGTGCAGACTGAATTCTAGGCTGGTCGCCCCCGAGCTTCTGTTGGACAAGGCACATGGGCCCCTCCCTCCAAGGCACTGGCAGGCTTGGCTCCAGGCGGGAGTGCCAGATCTGTGTCTCCGGGTGGAGGTGGGGCAGGGCTAGTATGCGTCTGGGGCTGGGCAGGGACGGCCCACCTGAGTCACTTTATTGGGTTCGGTCATACTTTGTTGCTCCGTTTTCTTTTCTGTGGGCTGATCTCAGCTTTCCTCCTTGTGCTGGGGGCTGAGCAGAGATGAGGGGGCTGGGAAGCTCTCAGTGGCCCCGATTCTCTGGGTCCTCCCTTCCTGCCCTTCCTCCGTGGCCTGCCTCCCTCGTGGGTCTTGCCATCCTTGCAGAGGGAGGTAAAGGCTTTGTCTGCTGTGACTCAGCCCTTGAATTCTCTGCCCTCGCCAAGGGCTCATTGGAACTGGGAACATGTAGCGCTGAGGCCCATCTTGGTCGCACTCCCCTCCTGCTCTCCCTGGCTGGGCCCACTGGCCAGTGTCAGAGTGGACACTGGCCTCACCTTTCCGATCCCGGGTGAGGGGAGGTTCAAGGAGGGGGTCTTCGGGCTAGAGTCAGGCTGGG