Transcript asmbl_260887

Sequence
Transcript Sequence for observation asmbl_260887 of TGE0001625:
CTCCCAAAGTGCCGGGATTACAGCCATAAGCCGCTGCGGCCGGCCGGTGGGTTACTTTTTGAATGTTTAATTCATTGTTTCTGCCAATAATTTGTACTAGGCAGCTCATAAGAACGCCAAAGTACGTTCCTTCTTCGACACAGGGCCAGTTTCCGCGCCAGTGCCCCCGTAGAGGGCGGGGCCCACTCGCTCGCGTAGCGTCACCTTCGCTTCCTGCCGCGCGGGGCCATTTCCGCTGCTGCTTCTGTGAGTTTTTCCGGTGCACGCGAGTGCTTCTGAAACGTCAGCTGCGCTCCCCTAGGAGTGCTGAGCCCGCGGAACCGCAGCCATGACTGAGGCTGATGTGAATCCAAAGGCCTATCCCCTTGCCGATGCCCACCTCACCAAGAAGCTACTGGACCTCGTTCAGCAGTCATGTAACTATAAGCAGCTTCGGAAAGGAGCCAATGAGGCCACCAAAACCCTCAACAGGGGCATCTCTGAGTTCATCGTGATGGCTGCAGACGCCGAGCCACTGGAGATCATTCTGCACCTGCCGCTGCTGTGTGAAGACAAGAATGTGCCCTACGTGTTTGTGCGCTCCAAGCAGGCCCTGGGGAGAGCCTGTGGGGTCTCCAGGCCTGTCATCGCCTGTTCTGTCACCATCAAAGAAGGCTCGCAGCTGAAACAGCAGATCCAATCCATTCAGCAGTCCATTGAAAGGCTCTTAGTCTAAACCTGTGGCCTCTGCCACGTGCTCCCTGCCAGCTTCCCCCCTGAGGTTGTGTATCATATTATCTGTGTTAGCATGTAGTATTTTCAGCTACTCTCTATTGTTATAAAATGTAGTACTAAATCTGGTTTCTGGATTTTTGTGTTGTTTTTGTTCTGTTTTACAGGGTTGCTATCCCCCTTCCTTTCCTCCCTCCCTCTGCCATCCTTCATCCTTTTATCCTCCCTTTTTGGAACAAGTGTTCAGAGCAGACAGAAGCAGGGTGGTGGCACCGTTGAAAGGCAGAAAGAGCCAGGAGAAAGCTGATGGAGCCAGGACAGAGATCTGGTTCCAGCTTTCAGCCACTAGCTTCCTGTTGTGTGCGGGGTGTGGTGGAATTAAACAGCATTCATTGTGTGTCCCTGTGCCTGGCACACAGAATCATTCATACGTGTTCAAGTGATCAAGGGGTTTCATTTGCTCTTGGGGGATTAGGTATCATTTGGGGAGGAAGCATGTGTTCTGTGAGGTTGTTCGGCTATGTCCAAGTGTCGTTTACTAATGTACCCCTGCTGTTTGCTTTTGGTAATGTGATGTTGATGTTCTCCCCCTACCCACAACCATGCCCTTGAGGGTAGCAGGGCAGCAGCATACCAAAGAGATGTGCTGCAGGACTCCGGAGGCAGCCTGGGTGGGTGAGCCATGGGGCAGTTGACCTGGGTCTTGAAAGAGTCGGGAGTGACAAGCTCAGAGAGCATGAACTGATGCTGGCATGAAGGATTCCAGGAAGATCATGGAGACCTGGCTGGTAGCTGTAACAGAGATGGTGGAGTCCAAGGAAACAGCCTGTCTCTGGTGAATGGGACTTTCTTTGGTGGACACTTGGCACCAGCTCTGAGAGCCCTTCCCCTGTGTCCTGCCACCATGTGGGTCAGATGTACTCTCTGTCACATGAGGAGAGTGCTAGTTCATGTGTTCTCCATTCTTGTGAGCATCCTAATAAATCTGTTCCATTTTGATGACA