Transcript asmbl_251935

Sequence
Transcript Sequence for observation asmbl_251935 of TGE0006790:
CAGCAGCAGCAGCAGCAGCAGCAATCTCTTCCCGAACACGAGCACCACAGGCGCCCGAAGGCCGGAACAGGCGTTTAGAGAAAATGGCAGACGATATTGATATTGAAGCAATGCTTGAGGCTCCTTACAAGAAGACTTGCCTAACGATATCTCACCTCTACTCCCATGAATTCACCTTTGATTCCAGTGTGAACTGTCAATCATAAGGATGAGAACAAGTTGAGCAGTGCCAACGGCCATGAAGAACGTAGCAAAAAGAGGAAAAAAAGCAAGAGCAGAAGTCGTAGTCATGAACGAAAGAGAAGCAAAAGTAAGGAACGGAAGCGAAGTAGAGACAGAGAAAGGAAAAAGAGCAAAAGCCGTGAAAGAAAGCGAAGTAGAAGCAAAGAGAGGCGACGGAGCCGCTCAAGAAGTCGAGATCGAAGATTTAGAGGCCGCTACAGAAGTCCTTACTCCGGACCAAAATTTAACAGTGCCATCCGAGGAAAGATTGGGTTGCCTCATAGCATCAAATTAAGCAGACGACGTTCCCGAAGCAAAAGTCCATTCAGAAAAGACAAGAGCCCTGTGAGAGAACCTATTGATAATTTAACTCCTGAGGAAAGAGATGCAAGGACAGTCTTCTGTATGCAGCTGGCGGCAAGAATTCGACCAAGGGATTTGGAAGAGTTTTTCTCTACAGTAGGAAAGGTTCGAGATGTGAGGATGATTTCTGACAGAAATTCAAGACGTTCCAAAGGAATTGCTTATGTGGAGTTCGTCGATGTTAGCTCAGTGCCTCTAGCAATAGGATTAACTGGCCAACGAGTTTTAGGCGTGCCAATCATAGTACAGGCATCACAGGCAGAAAAAAACAGAGCTGCAGCAATGGCAAACAATTTACAAAAGGGAAGTGCTGGACCTATGAGGCTTTATGTGGGCTCATTACACTTCAACATAACTGAAGATATGCTTCGTGGGATCTTTGAGCCTTTTGGAAGAATTGAAAGTATCCAGCTGATGATGGACAGTGAAACTGGTCGATCCAAGGGATATGGATTTATTACATTTTCTGACTCAGAATGTGCCAAAAAGGCTTTGGAACAACTTAATGGATTTGAACTAGCAGGAAGACCAATGAAAGTTGGTCATGTTACTGAACGTACTGATGCTTCGAGTGCTAGTTCATTTTTGGACAGTGATGAACTGGAAAGGACTGGAATTGATTTGGGAACAACTGGTCGTCTTCAGTTAATGGCAAGACTTGCAGAGGGTACAGGTTTGCAGATTCCGCCAGCAGCACAGCAAGCTCTACAGATGAGTGGCTCTTTGGCATTTGGTGCTGTGGCAGATTTGCAAACAAGACTTTCCCAGCAGACTGAAGCTTCAGCTTTAGCTGCAGCTGCCTCTGTTCAGCCACTTGCAACACAATGTTTCCAACTCTCTAACATGTTTAACCCTCAAACAGAAGAAGAAGTTGGATGGGATACCGAGATTAAGGATGATGTGATTGAAGAATGTAATAAACATGGAGGAGTTATTCATATTTATGTTGACAAAAATTCAGCTCAGGGCAATGTGTATGTGAAGTGCCCATCAATTGCTGCAGCTATTGCTGCTGTCAATGCATTGCATGGCAGGTGGTTTGCTGGTAAAATGATAACAGCAGCATATGTACCTCTTCCAACTTACCACAACCTGTTTCCTGATTCTATGACAGCAACACAGCTACTGGTTCCAAGTAGACGATGAAGGAAGATATAGTCCCTTATGTATATAGCTTTTTTTCTTTCTTGAGAATTCATCTTGAGTTATCTTTTATTTAGATAAAAATAAAGAGGCAAGGATCTACTGTCATTTGTATGCAATTTCCTGTTACCTTGAAAAAATAAAAATGTTAACAGGAATGCAGTGTGCTCATTCTCCCTAAATAGTAAATCCCACTGTATACAAAACTGTTCTCTTGTTCTGCCTTTTAAAATGTTCATGTAGAAAATTAATGAACTATAGGAATAGCTCTAGGAGAACAAATGTGCTTTCTGTAAAAAGGCAGACCAGGGATGTAATGTTTTTAATGTTTCAGAAGCCTAACTTTTTACACAGTGGTTACATTTCACATTTCACTAATGTTGATATTTGGCTGATGGTTGAGCAGTTTCTGAAATACACATTTAGTGTATGGAAATACAAGACAGCTAAAGGGCTGTTTGGTTAGCATCTCATCTTGCATTCTGATCAATTGGCAAGAAAGGGAGATTTCAAAATTATATTTCTTGATGGTATCTTTTCAATTAATGTATCTGTAAAAGTTTCTTTGTAAATACTATGTGTTCTGGTGTGTCTTAAAATTCCAAACAAAATGATCCCTGCATTTCCTGAAGATGTTTAAACGTGAGAGTCTGGTAGGCAAAGCAGTCTGAGAAAGAAATAGGAAATGCAGAAATAGGTTTTGTCTGGTTGCATATAATCTTTGCTCTTTTTAAGCTCTGTGAGCTCTGAAATATATTTTTGGGTTACTTCAGTGTGTTTGACAAGACAGCTTGATATTTCTATCAAACAAATGACTTTCATATTGCAACAATCTTTGTAAGAACCACTCAAATAAAAGTCTCTTAAAAAGGCCACAGGAGATCTTCATTTTTCAAATGTTTTAAAGTTACAGAAATTTGAGAACAGAATTAGCTTCTTTTAGTCTCAATTCAGTACTTGCCTCTTGGGAAAATGTTCCGAGTCTGCGGAAACTTGCCCTCACGTTGTCCCCCATGAATTCCTTTATTCTATTAGAGTCTAGCCCTGTGTATTTTAGAAGAATGTATCAAAACTGAGGGGTTTACCAAAAAGAAAAGGAAACAGCCTGGCCTTAAAACCTGGGCATTCTTGGTCTCCTGCATTGTCTGGGCATATTTATGAAGAAATTTTCACCATTTACAATACATACTTAACAAAATGGCTTAACTTCAAACTGGTTTCCAAAATTGATTTATATATTAATATATTAAATAAGGTGCATATATTACTGTATTAAGGGGTTTTGAGCTTTCATACTAGTTGGGAAGCAAGCTGTCACCATTTATACTCAATTCTCTTCAACTGTTTATCTCTTGGTAAATCTTTTGAGTAGGAAATGCTGCTCCTAGCTTATCTTCAAATACTGAGTTCCTTACCTCATTTGTTCAACTTTTTTTTTTGTTAGCATTGAAGCACAAGTTTTACAGGCTTATTCAGAATTTCATATCAGTCGTTTTGTTTGACATTTATCCCAATAATTGTTCTAGTGATTTAATTTGTATGGAAACTCCCAAGGTTCAATTTCTTTTTCTTTTTGAGATGGAGTCT