Transcript asmbl_251931

Sequence
Transcript Sequence for observation asmbl_251931 of TGE0006790:
CAGCAGCAGCAGCAGCAGCAGCAATCTCTTCCCGAACACGAGCACCACAGGCGCCCGAAGGCCGGAACAGGCGTTTAGAGAAAATGGCAGACGATATTGATATTGAAGCAATGCTTGAGGCTCCTTACAAGAAGGTGAGAAAAAACATGTCGGTGAGGTTTATATATTTCTTAATTTAGCATTATTCACGAAACTACTGCTGAAATGTAAACTAACCTCCCCGGAGCCCTCTTGATTTATCTTATCAGAGATGCATTACGTGTAACTTACAAAAGTAAATATATGCTATTGATGTAATAATATTGTGCAGTAGTTTCACTTCAGCGTGATGAATAAATGCCCATCTATCTCTCTTTGTAGACTTGCCTAACGATATCTCACCTCTACTCCCATGAATTCACCTTTGATTCCAGTGTGAACTGTCAATCATAAGGATGAGAACAAGTTGAGCAGTGCCAACGGCCATGAAGAACGTAGCAAAAAGAGGAAAAAAAGCAAGAGCAGAAGTCGTAGTCATGAACGAAAGAGAAGCAAAAGTAAGGAACGGAAGCGAAGTAGAGACAGAGAAAGGAAAAAGAGCAAAAGCCGTGAAAGAAAGCGAAGTAGAAGCAAAGAGAGGCGACGGAGCCGCTCAAGAAGTCGAGATCGAAGATTTAGAGGCCGCTACAGAAGTCCTTACTCCGGACCAAAATTTAACAGTGCCATCCGAGGAAAGATTGGGTTGCCTCATAGCATCAAATTAAGCAGACGACGTTCCCGAAGCAAAAGTCCATTCAGAAAAGACAAGAGCCCTGTGAGAGAACCTATTGATAATTTAACTCCTGAGGAAAGAGATGCAAGGACAGTCTTCTGTATGCAGCTGGCGGCAAGAATTCGACCAAGGGATTTGGAAGAGTTTTTCTCTACAGTAGGAAAGGTTCGAGATGTGAGGATGATTTCTGACAGAAATTCAAGACGTTCCAAAGGAATTGCTTATGTGGAGTTCGTCGATGTTAGCTCAGTGCCTCTAGCAATAGGATTAACTGGCCAACGAGTTTTAGGCGTGCCAATCATAGTACAGGCATCACAGGCAGAAAAAAACAGAGCTGCAGCAATGGCAAACAATTTACAAAAGGGAAGTGCTGGACCTATGAGGCTTTATGTGGGCTCATTACACTTCAACATAACTGAAGATATGCTTCGTGGGATCTTTGAGCCTTTTGGAAGAATTGAAAGTATCCAGCTGATGATGGACAGTGAAACTGGTCGATCCAAGGGATATGGATTTATTACATTTTCTGACTCAGAATGTGCCAAAAAGGCTTTGGAACAACTTAATGGATTTGAACTAGCAGGAAGACCAATGAAAGTTGGTCATGTTACTGAACGTACTGATGCTTCGAGTGCTAGTTCATTTTTGGACAGTGATGAACTGGAAAGGACTGGAATTGATTTGGGAACAACTGGTCGTCTTCAGTTAATGGCAAGACTTGCAGAGGGTACAGGTTTGCAGATTCCGCCAGCAGCACAGCAAGCTCTACAGATGAGTGGCTCTTTGGCATTTGGTGCTGTGGCAGATTTGCAAACAAGACTTTCCCAGCAGACTGAAGCTTCAGCTTTAGCTGCAGCTGCCTCTGTTCAGCCACTTGCAACACAATGTTTCCAACTCTCTAACATGTTTAACCCTCAAACAGAAGAAGAAGTTGGATGGGATACCGAGATTAAGGATGATGTGATTGAAGAATGTAATAAACATGGAGGAGTTATTCATATTTATGTTGACAAAAATTCAGCTCAGGGCAATGTGTATGTGAAGTGCCCATCAATTGCTGCAGCTATTGCTGCTGTCAATGCATTGCATGGCAGGTGGTTTGCTGGTAAAATGATAACAGCAGCATATGTACCTCTTCCAACTTACCACAACCTGTTTCCTGATTCTATGACAGCAACACAGCTACTGGTTCCAAGTAGACGATGAAGGAAGATATAGTCCCTTATGTATATAGCTTTTTTTCTTTCTTGAGAATTCATCTTGAGTTATCTTTTATTTAGATAAAAATAAAGAGGCAAGGATCTACTGTCATTTGTATGCAATTTCCTGTTACCTTGAAAAAATAAAAATGTTAACAGGAATGCAGTGTGCTCATTCTCCCTAAATAGTAAATCCCACTGTATACAAAACTGTTCTCTTGTTCTGCCTTTTAAAATGTTCATGTAGAAAATTAATGAACTATAGGAATAGCTCTAGGAGAACAAATGTGCTTTCTGTAAAAAGGCAGACCAGGGATGTAATGTTTTTAATGTTTCAGAAGCCTAACTTTTTACACAGTGGTTACATTTCACATTTCACTAATGTTGATATTTGGCTGATGGTTGAGCAGTTTCTGAAATACACATTTAGTGTATGGAAATACAAGACAGCTAAAGGGCTGTTTGGTTAGCATCTCATCTTGCATTCTGATCAATTGGCAAGAAAGGGAGATTTCAAAATTATATTTCTTGATGGTATCTTTTCAATTAATGTATCTGTAAAAGTTTCTTTGTAAATACTATGTGTTCTGGTGTGTCTTAAAATTCCAAACAAAATGATCCCTGCATTTCCTGAAGATGTTTAAACGTGAGAGTCTGGTAGGCAAAGCAGTCTGAGAAAGAAATAGGAAATGCAGAAATAGGTTTTGTCTGGTTGCATATAATCTTTGCTCTTTTTAAGCTCTGTGAGCTCTGAAATATATTTTTGGGTTACTTCAGTGTGTTTGACAAGACAGCTTGATATTTCTATCAAACAAATGACTTTCATATTGCAACAATCTTTGTAAGAACCACTCAAATAAAAGTCTCTTAAAAAGGCCACAGGAGATCTTCATTTTTCAAATGTTTTAAAGTTACAGAAATTTGAGAACAGAATTAGCTTCTTTTAGTCTCAATTCAGTACTTGCCTCTTGGGAAAATGTTCCGAGTCTGCGGAAACTTGCCCTCACGTTGTCCCCCATGAATTCCTTTATTCTATTAGAGTCTAGCCCTGTGTATTTTAGAAGAATGTATCAAAACTGAGGGGTTTACCAAAAAGAAAAGGAAACAGCCTGGCCTTAAAACCTGGGCATTCTTGGTCTCCTGCATTGTCTGGGCATATTTATGAAGAAATTTTCACCATTTACAATACATACTTAACAAAATGGCTTAACTTCAAACTGGTTTCCAAAATTGATTTATATATTAATATATTAAATAAGGTGCATATATTACTGTATTAAGGGGTTTTGAGCTTTCATACTAGTTGGGAAGCAAGCTGTCACCATTTATACTCAATTCTCTTCAACTGTTTATCTCTTGGTAAATCTTTTGAGTAGGAAATGCTGCTCCTAGCTTATCTTCAAATACTGAGTTCCTTACCTCATTTGTTCAACTTTTTTTTTTGTTAGCATTGAAGCACAAGTTTTACAGGCTTATTCAGAATTTCATATCAGTCGTTTTGTTTGACATTTATCCCAATAATTGTTCTAGTGATTTAATTTGTATGGAAACTCCCAAGGTTCAATTTCTTTTTCTTTTTGAGATGGAGTCT