Transcript asmbl_219287

Sequence
Transcript Sequence for observation asmbl_219287 of TGE0001355:
CCCTCGCCCCCTTCCGCGCGCTCGGTCCTCATTGGCCAGCGGCGCGCTGGGGGCGGGACTCTCGGGAGAAGCTCGGCGCATCATTGGGCGGTGGACCGCCCCTCGGCCCCGGGGTAGGCTGACACGGGAGGGTCCTCAGCTAAAGCCAAAAGCAGATCAAAGTGGTGGGACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGGGTCGGCGCTCGCCCTCGCTCTCCTCGCCCTCCGCCCCGGCCCCGGCCCCGCGCCCGCCATGGAGAAGACTGAGCTGATCCAGAAGGCCAAGCTGGCCGAGCAGGCCGAGCGCTACGACGACATGGCCACCTGCATGAAGGCAGTGACCGAGCAGGGCGCCGAGCTGTCCAACGAGGAGCGCAACCTGCTCTCCGTGGCCTACAAGAACGTGGTCGGGGGCCGCAGGTCCGCCTGGAGGGTCATCTCTAGCATCGAGCAGAAGACCGACACCTCCGACAAGAAGTTGCAGCTGATTAAGGACTATCGGGAGAAAGTGGAGTCCGAGCTGAGATCCATCTGCACCACGGTGCTGGAATTGTTGGATAAATATTTAATAGCCAATGCAACTAATCCAGAGAGTAAGGTCTTCTATCTGAAAATGAAGGGTGATTACTTCCGGTACCTTGCTGAAGTTGCGTGTGGTGATGATCGAAAACAAACGATAGATAATTCCCAAGGAGCTTACCAAGAGGCATTTGATATAAGCAAGAAAGAGATGCAACCCACACACCCAATCCGCCTGGGGCTTGCTCTTAACTTTTCTGTATTTTACTATGAGATTCTTAATAACCCAGAGCTTGCCTGCACGCTGGCTAAAACGGCTTTTGATGAGGCCATTGCTGAACTTGATACACTGAATGAAGACTCATACAAAGACAGCACCCTCATCATGCAGTTGCTTAGAGACAACCTAACACTTTGGACATCAGACAGTGCAGGAGAAGAATGTGATGCGGCAGAAGGGGCTGAAAACTAAATCCATACAGGGTGTCATCCTTCTTTCCTTCAAGAAACCTTTTTACACATCTCCATTCCTTATTCCACTTGGATTTCCTATAGCAAAGAAACCCATTCATGTGTATGGAATCAACTGTTTATAGTCTTTTCACACTGCAGCTTTGGGAAAACTTCATTCCTTGATTTGTGTTTGTCTTGGCCTTCCTGGTGTGCAGTACTGCTGTAGAAAAGTATTAATAGCTTCATTTCATATAAACATAAGTAACTCCCAAACACTTATGTAGAGGACTAAAAATGTATCTGGTATTTAAGTAATCTGAACCAGTTCTGCAAGTGACTGTGTTTTGTATTACTGTGAAAATAAGAAAATGTAGTTAATTACAATTTAAAGAGTATTCCACATAACTTCTTAATTTCTACATTCCCTCCCTTACTCTTCGGGGGTTTCCTTTCAGTAAGCAACTTTTCCATGCTCTTAATGTATTCCTTTTTAGTAGGAATCCGGAAGTATTAGATTGAATGGAAAAGCACTTGCCATCTCTGTCTAGGGGTCACAAATTGAAATGGCTCCTGTATCACATACGGAGGTCTTGTGTATCTGTGGCAACAGGGAGTTTCCTTATTCACTCTTTATTTGCTGCTGTTTAAGTTGCCAACCTCCCCTCCCAATAAAAATTCACTTACACCTCCTGCCTTTGTAGTTCTGGTATTCACTTTACTATGTGATAGAAGTAGCATGTTGCTGCCAGAATACAAGCATTGCTTTTGGCAAATTAAAGTGCATGTCATTTCTTAATACACTAGAAAGGGGAAATAAATTAAAGTACACAAGTCCAAGTCTAAAACTTTAGTACTTTTCCATGCAGATTTGTGCACATGTGAGAGGGTGTCCAGTTTGTCTAGTGATTGTTATTTAGAGAGTTGGACCACTATTGTGTGTTGCTAATCATTGACTGTAGTCCCAAAAAAGCCTTGTGAAAATGTTATGCCCTATGTAACAGCAGAGTAACATAAAATAAAAGTACATTTTATAAACCATTTACTATGGCTTTGTAACAATTGCATACCCATATTTTAAGGGACAGGTGAATTTACTACTTTCTAAAGTTTATTGATACTTCCCTTTTATGTAAAATGTAGTAGTGATACCTATATTTCCACATTGTGCATTGTGACACACTTGTCTAGGGATGCCTGGAAGTGTATAAAATTGGACTGCATTTCTTAGAGTGTTTTACTATAGATCAGTCTCATGGGCCATCTCTTCCTCAGATGTAAATGATATCTGGTTAAGTGTTATATGGAATAAAGTGGACATTTTAAAACTAGCAAAGTTAA