Transcript asmbl_47020

Sequence
Transcript Sequence for observation asmbl_47020 of TGE0005816:
CAGGATTCTTTTGTAGAACTCTCTCTTGGAATGATATTTTCATCATGAGCCAACAAGGTTATGTGGCGACACCACCCTATTCTCAGTCCCAGTCTGGGATGGGCCTTTCTCCACCGCATTACGGACACTATGGGGACCCGTCTCATGCAGCTCCTCCCCCAGGCATGATGAAGCCGGCAGGGCCTCTGGGGGCCGCTGCACCAGGGGCGATGTCACCACAGGGCCCTCCACCTCCTGGACCCCATCAGTTCAGCCAGAACGGAGCGCACGCCCAGGGTCACCCTTCCCAAAGATTTCCAGGACCTCCACCTGTCAACAGTGCAGCACCCTCATATGCACCGTATTCACCTGCCACACAGTCATCTTACGCAAGCCCCATGCCCGCCCCATCCGTCTCCCAGCTGGGCAGTCAGCTCGGTGCCGTGCACATCAACAGCTATGGTAACCAGTCAGGTCCAGCCCCCTCCAGCCAGGGCCCCCCGGGCCCTCCGTCAGCGCCATCATTCCAGGGCCCTCCACAGCCACCGCCACCATCCATCCTGCAGCCTGGGCCTCAAGTCCTTCCGCCACCACCCACTGCGCTCAATGGCCCAGGGGCGCCACCCCTGCCTCCGCCCACGCACAGGCAGGACGGGCTCGCTGGGCCCGCTCCCGCGAGGGCCCCGCTGCAGCCCCCACCTCTCCTGGGACAGGCTGTGGCCGCCGGCTACCCTCCGCAGCCAGCCAACTACAGCCCACAGATGCCAGGGGCGCAGCTCTCGTTCCCAGGAGGCTTCCCTGCAGGGCCCGCACAGATGGCAGGGCCACCTCCGCCCCAGAAGAAGCTGGACCCTGACTCTATCCCCAGTCCAATCCAGGTGATCGAGAATGACAGAGCTGCCAGAGGGGGACAAGTGTACGCCACCAATACCAGAGGCCAGGTCCCTCCCCTGGTCACCACAGACTGTGTGGTCCAAGACCAAGGCAACGCTAGTCCTCGGTACATTCGCTGCACGACGTACTGCTTCCCGTGCACGTCCGACATGGCCAAGCAAGCGCAGATCCCGCTAGCCGCGGTCATCACGCCCTTCGCCACCATTCCTTCAAATGAGACTCCCCTTTACTTGGTGAACCATGGAGAGACCGGGCCGGTCAGGTGCAACAGGTGCAAAGCCTACATGTGCCCGTTCATGCAGTTCATAGAGGGAGGACGGAGGTTCCAGTGTGGCTTCTGCAACTGCGTGAGCGACGTCCCGCCGTTCTATTTCCAACATCTGGACCACATGGGAAGAAGACTGGACCACTACGAGAAGCCGGAGTTATCTCTAGGATCTTACGAATACGTTGCTACTTTGGATTACTGCAGAAAGAGTAAGCCTCCCAGCCCGCCCGCCTTCATCTTCATGATCGACGTCTCCTACAGCAACATCAAGAACGGGCTCGTGAAGCTCATATGCGAGGAGCTGAAGACCGTGCTGGACAAGCTGCCCAAGGAAGAGCAGGAAGAGACTTCTGCCATCCGCGTCGGCTTCGTCACATACAACAAGGCCCTCCATTTCTTCAATGTCAAGAGTAATTTGGCCCAGCCTCAGATGATGGTGGTGACCGACGTGAGCGAGGTCTTCGTCCCTTTGCTGGATGGTTTCCTTGTCAACTATCAAGAATCCCAATCTGTGATTCACAATTTGCTGGACCAGATTCCCGAGATGTTCGCGGACTCCGCTGAGAACGAGACTGTCTTTGCCCCTGTCGTCCGGGCCGGCATGGAGGCCCTGAAGGCGGCGGACTGCCCCGGGAAGCTGTTCGTCTTCCACGCCTCGCTGCCCACCGCCGAGGCCCCGGGGAAGCTGAAGCCCAGGGACGACAGGAAGCTGGTGAACACGGACAAAGAGAAGATGCTGTTCCAGCCCCAGACCAGCGTCTACGACTCGCTGGCCAAGGACTGCGTGGCCCGGCTGCTCCTTTTTTTTTCCCAGTCAGCACGTGGACGTGGCCTCCCTGGGCCTCGTGCCCCATCTCACTGGAGGGACCCTTTACAAGTACAGCAACTTCCAGATGCACTTGGATAGCCAGCAATTCTTGAATGACCTCAGAAATGATATTGGGAAGAAAATAGGATTTGACGCCATAATGCGGGTCCGCACCAGCACAGGATTTAGAGCCACTGATTTCTTTGGCGGAATTTTTATGAACAACACCACCGATGTGGAGATGGCGGCCATCGATTGTGACAAGGCAGTGACTGTGGAGTTTAAGCACGATGACAAACTTAGTGAAGACAGTGGGGCCTTAATCCAGTGCGCTGTGCTTTACACGACCGTCGGCGGTCAGAGGAGACTGCGGATTCACAACCTTGGCCTGAACTGCAGCGCCCAGCTGGCCGACCTCTATAAGAGCTGTGAGACGGACGCCCTCATCAACTTCTTCGCCAAGTCAGCTTTCAAAGCAGTCCTGCACCAGCCCTTGAAGGTCATCCGGGAAATTCTCGTTAACCAGACCGCCCACATGTTGGCCTGCTACCGGAAGAACTGTGCCAGCCCATCCGCAGCCAGCCAGCTCATTCTGCCGGATGCCATGAAGGTGCTGCCCGTGTACATGAACTGCTTGCTGAAGACCTGCGTGCTGCTCGGCCGGCCGGACGTCGCGGTGGACGAGCGCGCCTTCCAGCGCCAGCTGGTCCTGACCATGGGTGTGGCCGACTCGCAGCTCTTCTTCTACCCGCAGCTCCTGCCCATCCACACGTTAGACGTCACGAGCACGGCAGTGCCCGCTGCCATTCGCTGCTCCGAGTCGCGCCTTTCGGAGGACGGAGTGTTCCTGCTGGTGAACGGCCTGAACGTGTTCCTGTGGCTGGGCGCCAGCAGCCCGCCCGAGCTCATCCAGGGGATATTCAGCGTGCCGTCGCTGGCACACGTCAGCACAGACATGACGTTACTGCCTGAGGTAGGAAACCCGTATTCTCAAACACTCAGGACAATAATGAGTACCATCCAACAAAAGAGGCCATATTCAATGAAGCTCGTGATCGTAAAGCAGCGAGAACAGGCAGAAATGCTCTTCCGGCAGCTCCTGGTGGAGGACAAGGGACCCCACGGAGGGCCGTCTTACGTGGATTTCCTCTGCTGTGTGCACAAGGAGATCTGTCAGCTGCTGAATTAGCGGAGCCTTCTGTGTTGGCGTTGCGTTTCTAGGGAAATCATCTCCTTCTTGGCGGCTGATTCTCCAGATGACAGCGGGCTCGCTTTGATTCCTTGCTCCTTTTCAGAGTGGCTTTCCACAGCATTCAGACCTTCAGCTTTGGTGCTCAGGTGCGAAGCCAGCGAAGGGACAGCTGTACCTCAAAGGGAACAGTCTGTTTCTATTGTACAATTTTTAACTGTTAAGACTGATGATATACTTTTGCATTTCATGAAAGGCACAGTTTTACAAAACTGTAAACATTCTCAATTTTCCTTCTTTGTGCCAGACATTTAAATTATTTTTCAAAATGTATAGATTTGGGGAAAAGGTTGTCTTGGCTCATCTCCTATTTGCAGTGAGAGGAAAAAAACTTAATTTTTACATTATATCTAATTTTTTTAAACCACGTAACCCCACTGAACATTTTCCACTTGAGGTTTGCATAGCGGACTTTTAATAACCTTGGAATCTATTGGTAGGACCATGTGCGTTCTACATTTTTTTCATAATTCTATGTTGTGTATGTTAAACTATTTTCCGATTGTCTATAAAATTGTCTATCAATACTCTCAAATGGTTCTCTGTACAATAATGAAGGTTTCTACCTGTATATAATGGATCTTAACCAGTATCAATAAATCCCTTCGTATGCTCTA