Transcript asmbl_217362

Sequence
Transcript Sequence for observation asmbl_217362 of TGE0001397:
GGGATTACAAGCGTGAGCCACCGCGCCCTGCCCAGTGGAATACTTTCAACGGTGCTTCTGCATTGACTTCCCATCTTCCAACCCATCCACAAACTGCAGCCAAAATGATGTTACTACAGTAACAACTTGGAGAAAGCAGTGTGGCTTAATCTGGAAGGAGCAGAAGCTGTGGAGTCCAAAGGACCCGTGTTCCTATCCTTGTTGTGCCACTTGACACGTTTAGCACAAGGGTCCCCACAGTGTTAGTTCACCGTCTCCAGCAATCACTATGACTCCCTGGAGGGCTGTCAAACGAAACAAAGGCGCAAACTGAGACAATTCCATTGTTTACGTAACTTTCGCCAAATCGGCTCCTTCCTACGAAATATCCAGCTCATAGAGCAGGCTGAGATGCTTTGTTGCTTTAATTCTCTTTAAGAGTCACAGCTGTCCATTTTCCACGTGCGGCTGAAGAATGGATTTCAGAGCGCTCTCCCTCCGGCAGTGTTCACCTAGTAACCCCTTCCGGATAAGGACCTGCAGCCCGGGCGCGACCCGGAAAGGGAATCCGCCCTTTTCGCCTCCTTCGCGCCAATCGCCTGGAGTTGGCGTTTCCGCAGCCGGGACACAGCCCACCCTCTAAGAGCCGCGGAGTCGGGGACGGTAGAAGGGGCCGCGCGTGCGCAGTGGCGTCCGCTGTGCTTCCGGTGCGCCGGGCGCGGACGCGGGCACGCACACACGCAAGCACGCCTCCACTTAACTCGCGCCGCCGCGGCAGCTCGAGTCCACCAGCAGCGCCGTCCGCTTGACCGAGATGCTGCGGGCCTGTCAGTTATCGGGTGTGACCGCCGCCGCCCAGAGTTGTCTCTGTGGGAAGTTTGTCCTCCGTCCATTGCGACCATGCCGCAGATACTCTACTTCAGGCAGCTCTGGGTTGACTACTGGCAAAATTGCTGGAGCTGGCCTTTTGTTTGTTGGTGGAGGTATTGGTGGCACTATCCTATATGCCAAATGGGATTCCCATTTCCGGGAAAGTGTAGAGAAAACCATACCTTACTCAGACAAACTCTTCGAGATGGTTCTTGGTCCTGCAGCTTATAATGTTCCATTGCCAAAGAAATCGATTCAGTCGGGTCCACTAAAAATCTCTAGTGTATCAGAAGTAATGAAAGAATCTAAACAGCCTGCCTCACAACTCCAAAAACAAAAGGGAGATACTCCAGCTTCAGCAACAGCAGGTGATACCCTGTCGGTCCCAGCCCCTGCAGTTCAGCCTGAGGAATCTTTAAAAACTGATCACCCTGAAATTGGTGAAGGAAAACCCACACCTGCACTTTCAGAAGCATCCTCATCTTCTATAAGGGAGCGACCACCTGAAGAAGTTGCAGCTCGCCTTGCACAACAGGAAAAACAAGAACAAGTTAAAATTGAGTCTCTAGCCAAGAGCTTAGAAGATGCTCTGAGGCAAACTGCAAGTGTCACTCTGCAGGCTATTGCAGCTCAGAATGCTGCGGTCCAGGCTGTCAATGCACACTCCAACATATTGAAAGCCGCCATGGACAATTCTGAGATTGCAGGCGAGAAGAAATCTGCTCAGTGGCGCACAGTGGAGGGTGCATTGAAGGAACGCAGAAAGGCAGTAGATGAAGCTGCCGATGCCCTTCTCAAAGCCAAAGAAGAGTTAGAGAAGATGAAAAGTGTGATTGAAAATGCAAAGAAAAAAGAGGTTGCTGGGGCCAAGCCTCATATAACTGCTGCAGAGGGTAAACTTCACAACATGATAGTTGATCTGGATAATGTGGTCAAAAAGGTCCAAGCAGCTCAGTCTGAGGCTAAGGTTGTATCTCAGTATCATGAGCTGGTGGTCCAAGCTCGGGATGACTTTAAACGAGAGCTGGACAGTATTACTCCAGAAGTCCTTCCTGGGTGGAAAGGAATGAGTGAGTACAACTGAACTGACAAGCTCTCTACTGATGATCTGAACTCCCTCATTGCTCATGCACATCGTCGTATTGATCAGCTGAACAGAGAGCTGGCAGAACAGAAGGCCACCGAAAAGCAGCACATCACGTTAGCCTTGGAGAAACAAAAGCTGGAAGAAAAGCGGGCATTTGACTCTGCAGTAGCAAAAGCATTAGAACATCACAGAAGTGAAATACAGGCTGAACAGGACAGAAAGATAGAAGAAGTCAGAGATGCCATGGAAAATGAAATGAGAACCCAGCTTCGCCGACAGGCAGCTGCCCACACTGATCACTTGCGAGATGTCCTTAGGGTACAAGAACAGGAATTGAAGTCTGAATTTGAGCAGAACCTGTCTGAGAAACTCTCTGAACAAGAATTACAATTTCGTCGTCTCAGTCAAGAGCAAGTTGACAACTTTACTCTGGATATAAATACTGCCTATGCCAGACTCAGAGGAATCGAACAGGCTGTTCAGAGCCATGCAGTTGCTGAAGAGGAAGCCAGAAAAGCCCACCAACTCTGGCTTTCAGTGGAGGCATTAAAGTACAGCATGAAGACCTCATCTGCAGAAACACCTACTATCCCGCTGGGTAGTGCAGTTGAGGCCATCAAAGCCAACTGTTCTGATAATGAATTCACCCAAGCTTTAACCGCAGCTATCCCTCCAGAGTCCCTGACCCGTGGGGTGTACAGTGAAGAGACCCTTAGAGCCCGTTTCTATGCTGTTCAAAAACTGGCCCGAAGGGTAGCAATGATTGATGAAACCAGAAATAGCTTGTACCAGTACTTCCTCTCCTACCTACAGTCCCTGCTCCTATTCCCACCTCAGCAACTGAAGCCGCCCCCAGAGCTCTGCCCTGAGGATATAAACACATTTAAATTACTGTCATATGCTTCCTATTGCATTGAGCATGGTGATCTGGAGCTAGCAGCAAAGTTTGTCAATCAGCTGAAGGGGGAATCCAGACGAGTGGCACAGGACTGGCTGAAGGAAGCCCGAATGACCCTAGAAACGAAACAGATAGTGGAAATCCTGACAGCATATGCCAGCGCCGTAGGAATAGGAACCACTCAGGTGCAGCCAGAGTGAGGTTTAGGAAGATTTTCATAAAGTCATATTTCATGTCAAAGGAAATCAGCAGTGATAGATGAAGGGTTCGCAGCGAGAGTCCCGGACTTGTCTAGAAATGAGCAGGTTTACAAGTACTGTTCTAAATGTTAACACCTGTTGCATTTATATTCTTTCCATTTGCTATCATGTCAGTGAACGCCAGGAGTGCTTTCTTTGCAACTTGTGTAACATTTTCTGTTTTTTCAGGTTTTACTGATGAGGCTTGTGAGGCCAATCAAAATAATGTTTGTGATCTCTACTACTGTTGATTTTGCCCTCGGAGCAAACTGAATAAAGCAACAAGATGAAAACTGAGTATCTTATCCCTTTTCAAAAAGTACAGTTCTGGCCAGGTGCAGTAGCTCACGCCTGTAATCCC