Transcript asmbl_11414

Sequence
Transcript Sequence for observation asmbl_11414 of TGE0000105:
CGCGGAGAGAGGAGCTAGGAGCCTCGGCCAATGGGAGCCGGCGTTGTTGGAGGCCACGGCGGCGCAGCCCCAAAGCGAGCGAAGCTAGGGTCGCCGCCACTGCCGCAGGAGGCGTGAGGGGATAAAAACATTCAGATGGCAGATCACAGTTTTTCAGATGGGGTTCCTTCAGATTCCGTGGAAGCTGCTAAAAATGCAAGTAACACAGAAAAGCTCACAGATCAGGTGATGCAGAATCCTCGAGTTCTGGCAGCTTTACAGGAGCGACTTGACAATGTCCCTCACACCCCTTCCAGCTACATCGAAACTTTACCTAAAGCAGTAAAAAGAAGAATTAATGCATTGAAACAACTTCAGGTGAGATGTGCTCACATAGAAGCCAAGTTCTATGAAGAGGTACATGACTTGGAAAGAAAGTATGCAGCGCTATACCAGCCTCTCTTTGACAAGAGAAGAGAATTTATCACCGGCGATGTTGAACCAACAGATGCGGAATCGGAATGGCACAGTGAAAATGAAGAGGAAGAGAAATTGGCTGGAGACATGAAAAGTAAAGTAGTCGTCACAGAAAAAGCAGCGGCAACGGCTGAAGAGCCAGATCCCAAAGGAATTCCAGAGTTCTGGTTTACCATCTTCAGAAATGTGGACATGCTGAGTGAATTAGTCCAGGAATATGATGAACCAATCTTGAAACACCTGCAGGATATTAAAGTGAAATTTTCTGACCCTGGACAGCCTATGTCTTTTGTGTTAGAGTTCCACTTTGAACCCAACGACTACTTTACCAACTCAGTCCTGACAAAAACCTACAAGATGAAATCAGAACCAGATAAGGCTGATCCCTTTTCCTTTGAAGGTCCTGAGATTGTGGACTGTGACGGGTGTACTATTGACTGGAAGAAAGGAAAGAATGTTACTGTCAAAACCATCAAGAAAAAGCAGAAGCATAAGGGTCGAGGCACTGTTAGAACAATTACGAAACAAGTACCCAATGAGTCCTTTTTCAACTTCTTCAATCCATTGAAAGCATCCGGGGATGGAGAATCACTGGATGAAGATTCTGAATTCACATTAGCCTCTGATTTTGAAATTGGACACTTTTTCCGTGAGCGGATAGTCCCGCGGGCTGTGCTGTACTTCACTGGGGAGGCCATAGAAGATGATGACAATTTTGAAGAAGGTGAAGAAGGAGAAGAGGAGGAATTAGAAGGTGACGAGGAGGGAGAAGACGAGGATGATGCGGAAATTAACCCCAAGGTGTAATTTTTGTCTGTTAATCATTCATACGTTTCT