Transcript asmbl_216274

Sequence
Transcript Sequence for observation asmbl_216274 of TGE0001358:
GGGCCGGGCCGGGCTGGGCCGGGCTGGGCCGGGCGGGCCCCTGGGAGCAGCCCCCAGGCGGGGGACCGCCTTGGAGACCCGAAGCCGGAGCTAGAGGCAGGCGGTGGGCCCGGGTGGAGTCCCGGCCGGAGCTGGTGGTTCGGGGGCGGTGCTAGGCCCCGAGGCTGCGGGACCTGAGCGCGAGGAGCCTGAGTGCGGGTCCAGCGGTGGCGGCATGAGCCGGCCCCCGCCGACGGGGAAAATGCCCGGCGCCCCCGAGACCGCGCCGGGGGACGGGGCAGGCGCGAGCCGCCAGAGGAAGCTGGAGGCGCTGATCCGAGACCCTCGCTCCCCCATCAACGTGGAGAGCTTGCTGGATGGCTTAAATTCCTTGGTCCTTGATTTAGATTTTCCTGCTTTGAGGAAAAACAAGAACATAGATAATTTCTTAAATAGATATGAGAAAATTGTGAAAAAAATCAGAGGTCTACAGATGAAGGCAGAAGACTATGATGTTGTAAAAGTTATTGGAAGAGGTGCTTTTGGTGAAGTGCAGTTGGTTCGTCACAAGGCATCGCAGAAGGTTTATGCTATGAAGCTTCTTAGTAAGTTTGAAATGATAAAAAGATCAGATTCTGCCTTTTTTTGGGAAGAAAGAGATATTATGGCCTTTGCCAATAGCCCCTGGGTGGTTCAGCTTTTTTATGCCTTTCAAGATGATAGGTATCTGTACATGGTAATGGAGTACATGCCTGGTGGAGACCTTGTAAACCTTATGAGTAATTATGATGTGCCTGAAAAATGGGCCAAATTTTACACTGCTGAAGTTGTTCTTGCTCTGGATGCAATACACTCCATGGGTTTAATACACAGAGATGTGAAGCCTGACAACATGCTCTTGGATAAACATGGACATCTAAAATTAGCAGATTTTGGCACGTGTATGAAGATGGATGAAACAGGCATGGTACATTGTGATACAGCAGTTGGAACACCGGATTATATATCACCTGAGGTTCTGAAATCACAAGGGGGTGATGGTTTCTATGGGCGAGAATGTGATTGGTGGTCTGTAGGTGTTTTCCTTTATGAGATGCTAGTGGGGGATACTCCATTTTATGCGGATTCACTTGTAGGAACATATAGCAAAATTATGGATCATAAGAATTCACTGTGTTTCCCTGAAGATGCAGAAATTTCCAAACATGCAAAGAATCTCATCTGTGCTTTCTTAACAGATAGGGAGGTACGACTTGGGAGAAATGGGGTGGAAGAAATCAGACAGCATCCTTTCTTTAAGAATGATCAGTGGCATTGGGATAACATAAGAGAAACGGCAGCTCCTGTAGTACCTGAACTCAGCAGTGACATAGACAGCAGCAATTTCGATGACATTGAAGATGACAAAGGAGATGTAGAAACCTTCCCAATTCCTAAAGCTTTTGTTGGAAATCAGCTGCCTTTCATCGGATTTACCTACTATAGAGAAAATTTATTATTAAGTGACTCTCCATCTTGTAGAGAAACTGATTCCATACAATCAAGGAAAAATGAAGAAAGTCAAGAGATTCAGAAAAAACTGTATACATTAGAAGAACATCTTAGCAATGAGATGCAAGCCAAAGAGGAACTGGAACAGAAGTGCAAATCTGTTAATACTCGCCTAGAAAAAACAGCAAAGGAGCTAGAAGAGGAGATTACCTTACGGAAAAGTGTGGAATCAGCATTAAGACAGTTAGAAAGAGAAAAGGCGCTTCTTCAGCACAAAAATGCAGAATATCAGAGGAAAGCTGATCATGAAGCAGACAAAAAACGAAATTTGGAAAATGATGTTAACAGCTTAAAAGATCAACTTGAAGATTTGAAAAAAAGAAATCAAAACTCTCAAATATCCACTGAGAAAGTGAATCAACTCCAGAGACAACTGGATGAAACCAATGCTTTACTGCGAACAGAGTCTGATACTGCAGCCCGGTTAAGGAAAACCCAGGCAGAAAGTTCAAAACAGATTCAGCAGCTGGAATCTAACAATAGAGATCTACAAGATAAAAACTGCCTGCTGGAGACTGCCAAGTTAAAACTTGAAAAGGAATTTATCAATCTTCAGTCAGCTCTAGAATCTGAAAGGAGGGATCGAACCCATGGATCAGAGATAATTAATGATTTACAAGGTAGAATATGTGGCCTAGAAGAAGATTTAAAGAACGGCAAAATCTTACTAGCGAAAGTAGAACTGGAGAAGAGACAACTTCAGGAGAGATTTACTGATTTGGAAAAGGAAAAAAGCAACATGGAAATAGATATGACATACCAACTAAAAGTTATACAGCAGAGCCTAGAACAAGAAGAAGCTGAACATAAGGCCACAAAGGCACGACTAGCAGATAAAAATAAGATCTATGAGTCCATCGAAGAAGCCAAATCAGAAGCCATGAAAGAAATGGAGAAGAAGCTCTTGGAGGAAAGAACTTTAAAACAGAAAGTGGAGAACCTATTGCTAGAAGCTGAGAAAAGATGTTCTCTATTAGACTGTGACCTCAAACAGTCACAGCAGAAAATAAATGAGCTCCTTAAACAGAAAGATGTGCTAAATGAGGATGTTAGAAACCTGACATTAAAAATAGAGCAAGAAACTCAGAAGCGCTGCCTTACACAAAATGACCTGAAGATGCAAACACAACAGGTTAACACACTAAAAATGTCAGAAAAGCAGTTAAAGCAAGAAAATAACCATCTCATGGAAATGAAAATGAACTTGGAAAAACAAAATGCTGAACTTCGAAAAGAACGTCAGGATGCAGATGGGCAAATGAAAGAGCTCCAGGATCAGCTCGAAGCAGAACAGTATTTCTCAACCCTTTATAAAACACAAGTTAGGGAGCTTAAAGAAGAATGTGAAGAAAAGACCAAACTTGGTAAAGAATTGCAGCAGAAGAAACAGGAATTACAGGATGAACGGGACTCTTTGGCTGCCCAACTGGAGATCACCTTGACCAAAGCAGATTCTGAGCAACTGGCTCGTTCAATTGCTGAAGAACAATATTCTGATTTGGAAAAAGAGAAGATCATGAAAGAGCTGGAGATCAAAGAGATGATGGCTAGACACAAACAGGAACTTACGGAAAAAGATGCTACAATTGCTTCTCTTGAGGAAACTAATAGGACACTAACTAGTGATGTTGCCAATCTTGCAAATGAGAAAGAAGAATTAAATAACAAATTGAAAGATGTTCAAGAGCAACTGTCAAGATTGAAAGATGAAGAAATAAGCGCAGCAGCTATTAAAGCACAGTTTGAGAAGCAGCTATTAACAGAAAGAACACTCAAAACTCAAGCTGTGAATAAGTTGGCTGAGATCATGAATCGAAAAGAACCTGTCAAGCGTGGTAATGACACAGATGTGCGGAGAAAAGAGAAGGAGAATAGAAAGCTACATATGGAGCTTAAATCTGAACGTGAGAAATTGACCCAGCAGATGATCAAGTATCAGAAAGAACTGAATGAAATGCAGGCACAAATAGCTGAAGAGAGCCAGATTCGAATTGAACTGCAGATGACATTGGACAGTAAAGACAGTGACATTGAGCAGCTGCGGTCACAACTCCAAGCCTTGCATATTGGTCTGGATAGTTCCAGTATAGGCAGTGGACCAGGGGATGCTGAGGCAGATGATGGGTTTCCAGAATCAAGATTAGAAGGATGGCTTTCATTGCCTGTACGAAACAACACTAAGAAATTTGGATGGGTTAAAAAGTATGTGATTGTAAGCAGTAAGAAGATTCTTTTCTATGACAGTGAACAAGATAAAGAACAATCCAATCCTTACATGGTTTTAGATATAGACAAGTTATTTCATGTCCGACCAGTTACACAGACAGATGTGTATAGAGCAGATGCTAAAGAAATTCCAAGGATATTCCAGATTCTGTATGCCAATGAAGGAGAAAGTAAGAAGGAACAAGAATTTCCAGTGGAGCCAGTTGGAGAAAAATCTAATTATATTTGCCACAAGGGACATGAGTTTATTCCTACTCTTTATCATTTCCCAACCAACTGTGAGGCTTGTATGAAGCCCCTGTGGCACATGTTTAAGCCTCCTCCTGCTTTGGAGTGCCGCCGTTGCCATATTAAGTGTCATAAAGATCATATGGACAAAAAGGAGGAGATTATAGCACCTTGCAAAGTATATTATGATATTTCAACGGCAAAGAATCTGTTATTACTAGCAAATTCTACAGAAGAGCAGCAGAAGTGGGTTAGTCGGTTGGTGAAAAAGATACCTAAAAAGCCCCCAGCTCCAGACCCTTTTGCCCGATCATCTCCTAGAACTTCAATGAAGATACAGCAAAACCAGTCTATTAGACGGCCAAGTCGACAGCTTGCCCCAAACAAACCTAGCTAACTGCCTTCTATGAAAGCAGTCATTATTCAAGGTGATCGTATTCTTCCAGTGAAAACAAGACTGAAATATGATGGCCCAAAATTTATTAAAAAGCTATATTTTCCTGAGAGACTGATACATACACTCATACATATATGTGTTCCCCTTTTCCCTGTAATATAAATTACAAATCTGGGCTCCTTTGAAGCAACAGGTTGAACCAACAATGATTGGTTGATAGACTAAGGATATATGCAACTCTTCCAGACTTTTCCATAAAGCTCTCTCGGCAGTCGCTCACACTACAATGCACACAAGGATTGAGAAGAGTTAAAGGCTAAAGAAAACATCTTTTCTAGCTTCAACAGAGAGGTTTCACCAGCACATTTACCAGAAGAATCTGGGAATGGATTCCACTACAGTGATATTGACTGCATCTTTAAGAAGTGACCATTATACTGTGTATATATATATAAACACACACACATATATATATATAT