Transcript asmbl_215088

Sequence
Transcript Sequence for observation asmbl_215088 of TGE0060458:
AAAAAAAGAAAAAAGAAAAAAAGGCGCAAAGGCTCCGTTCAGGCCCTAGATCCCGCGATACAAACTTTCTCGGCCCGCCCCAGCCCGCTGTGGCGGGAACATTCTGGAAGTGACGGCAATCTCTGCGGCAGTCTTCTGTCGGAAGTGACGTTGCTATCCCAGAATCCTCAGAGAAGGAGTAGCGCGTTCGTGCGTCCTAGTTCCAGTACAGCGTGGAGGGTTTAGGCAGCGTGTTCTGATTCTTTGCGGGACGGCGAGCGCATTTGTGCTTTGCCCGCCGCGGCCTAGGAGGCCTTTTGAGGCCGCGTAGTCGGTGTTTTTGAACTGACTCTACAGCTTCTGGCAGGCCGTGCGGCGCCCTGACCCGGCCTCACCATGTTGGTGCTGTTTGAAACGTCTGTGGGTTACGCCATCTTTAAGGTTCTAAATGAGAAGAAACTTCAAGAGGTTGATAGTTTATGGAAAGAATTTGAAACTCCAGAGAAAGCAAACAAAATAGTAAAGCTAAAACATTTTGAGAAATTTCAGGATACAGCAGAAGCATTAGCAGCATTCACAGCTCTGATGGAGGGCAAAATCAATAAGCAGCTGAAAAAAGTTCTGAAGAAAATAGTAAAAGAAGCCCATGAACCGCTGGCAGTAGCTGATGCTAAACTAGGAGGGGTCATAAAGGAAAAGCTGAATCTCAGTTGTATCCATAGTCCTGTTGTTAATGAACTTATGAGAGGAATTCGTTCACAAATGGATGGATTAATCCCTGGGGTAGAACCACGTGAAATGGCAGCTATGTGTCTTGGATTGGCTCACAGCCTGTCTCGATATAGATTGAAGTTTAGCGCTGATAAAGTAGACACAATGATTGTTCAGGCAATTTCCTTGTTAGATGACTTGGATAAAGAACTAAACAACTACATTATGCGATGTAGAGAATGGTATGGCTGGCATTTCCCTGAATTAGGAAAAATTATTTCAGATAATTTAACATACTGCAAGTGTTTACAGAAAGTTGGCGATAGGAAGAACTATGCCTCTGCCAAGCTTTCTGAGTTGCTGCCAGAAGAAGTTGAAGCAGAAGTGAAAGCAGCTGCAGAGATATCAATGGGAACAGAGGTTTCAGAAGAAGATATTTGCAATATTCTGCATCTTTGCACCCAGGTGATTGAAATCTCTGAATATCGAACCCAGCTCTATGAATATCTACAAAATCGAATGATGGCCATTGCACCCAATGTTACAGTCATGGTTGGGGAATTAGTTGGAGCACGGCTTATTGCTCATGCAGGTTCTCTTTTAAATTTGGCCAAGCATGCAGCTTCTACCGTTCAGATTCTTGGAGCTGAAAAGGCACTTTTCAGAGCCCTCAAATCTAGACGGGATACCCCTAAGTATGGTCTCATTTATCATGCTTCACTCGTGGGCCAGACAAGTCCCAAACACAAAGGAAAGATTTCTCGAATGCTGGCAGCCAAAACCGTTTTGGCTATCCGTTATGATGCTTTTGGTGAGGATTCAAGTTCTGCAATGGGAGTTGAGAACAGAGCCAAATTAGAGGCCAGGTTGAGAACTTTGGAAGACAGAGGGATAAGAAAAATAAGTGGAACAGGAAAAGCATTAGCAAAAACAGAAAAATATGAACACAAAAGGTGAGTACATTTAAGTGAGGATGGGGTGAATAGTTTTTTTAAATGTTAATTATTGACAGTAATTTTTTATTGTAAACTTCACCTTGATGTGCCCATAGTTTTTTCAAATTTATTTATTTGACCAAAATTGTGTATGTTTATTGTGTGTATGTTGTTTTGGAAAATGTGCACATTGAGGAATGATTAAGTCAAGCTCATTAACATGCATTGTCTTATGTACTTTTTTTGTGGTGAGGACACCTTAAAATCTACTTAGCAATTTTCAAGAATATAATACATTGTTAGCTGTAGTTAACCATGTTGTGCACCCCTAATTTTTTTCCATGCCATTTAGTTTTCCGCATTAACTTCTACTAGTTTTCATTCATATACATATTTAATTTATTCATTTCCAGATATTGATAGTAAATTTTTTTAATCTAAAGTTCCTCTATAATATGTTCTTTATCAAAAAGTTCACTCAGCCGGGCACAGTGGCTCATGCCTGTAA