Transcript asmbl_215030

Sequence
Transcript Sequence for observation asmbl_215030 of TGE0001320:
CGGTGCTGGAGGAGGGGGCCGGCGGCGAGGGACTCCAGGAGGACGCGTCCAACTTCGAGACCGGCGGGGGCCGGCTCCGCTCTTCCAACCCCTCCATGTGTGAAGAGGGCGGACGACGCAGCGGGGGAAGAAAAATAAGCTAGTCTAGGACAAGTGTCCAGGCGACGTGGAACCCAGTAAGGGAATAAAGAAGACTGGAAACGTCTCTCCCCTCCCCTATCCCAGTCCCTCACCCTAATCCGCGCGCAATAGAAAAGGCGGAAGCGCCTGTCCACGATCAGGGCGGGGCAAGGGGAAGAAATCTCGCGATAGGAGAGCGGTCCGGGCGGGGGTGGCACCTCTCCCTCCTCCTGGCGTTAGTTCCGGTCGCAGAGGAGACACCGCCGCAGTTGCCGGTACATCGGGGATTTCTGGCTCTTTCCTCTTCGCCTTAAATTCGGGTGTCTTTTATGAATAATCAAAAGCAGCAAAAGCCAACGCTATCAGGCCAGCGTTTTAAAACTAGAAAAAGAGATGAAAAAGAGAGGTTTGACCCTACTCAGTTTCAAGACTGTATTATTCAAGGCTTAACTGAAACCGGTACTGATTTGGAAGCAGTAGCTAAGTTTCTTGATGCTTCTGGAGCAAAACTTGATTACCGTCGATATGCAGAAACACTCTTTGACATTCTGGTGGCTGGTGGAATGCTGGCCCCAGGTGGTACACTGGCAGATGACATGATGCGTACAGATGTCTGCGTGTTTGCAGCCCAAGAAGATCTAGAGACCATGCAAGCATTTGCTCAGGTTTTTAACAAGTTAATCAGGCGCTACAAATACCTGGAGAAAGGTTTTGAAGATGAAGTAAAAAAGCTGCTGCTGTTCTTGAAGGGTTTTTCAGAGTCGGAGAGGAACAAGCTAGCTATGTTGACTGGTGTTCTTCTGGCTAATGGAACACTTAATGCATCCATTCTTAATAGCCTTTATAATGAAAATTTGGTTAAAGAAGGAGTTTCAGCAGCTTTTGCTGTGAAGCTCTTTAAATCATGGATAAATGAAAAAGATATCAATGCAGTAGCTGCAAGTCTTCGGAAAGTCAGCATGGATAACAGACTGATGGAACTCTTTCCTGCCAATAAGCAAAGTGTTGAACACTTCACAAAATATTTTACTGAGGCAGGCTTGAAAGAGCTTTCAGAATATGTTCGGAATCAGCAAACCATCGGAGCTCGTAAGGAGCTCCAGAAAGAACTTCAAGAACAGATGTCCCGTGGTGATCCATTTAAGGATATAATTTTATATGTCAAGGAGGAGATGAAAAAAAACAACATCCCAGAGCCAGTTGTCATCGGAATAGTCTGGTCAAGTGTAATGAGCACTGTGGAATGGAACAAAAAAGAGGAGCTTGTAGCAGAGCAAGCCATCAAGCACTTGAAGCAATACAGCCCTCTACTTGCTGCCTTTACTACTCAAGGTCAGTCTGAGCTGACTCTGTTACTGAAGATTCAGGAGTATTGCTATGACAACATTCATTTCATGAAAGCCTTCCAGAAAATAGTGGTGCTTTTTTATAAAGCTGAAGTCCTGAGCGAGGAGCCCATTTTGAAGTGGTATAAAGATGCACATGTTGCAAAGGGGAAGAGTGTTTTCCTTGAGCAAATGAAAAAGTTTGTAGAATGGCTCAAAAATGCTGAAGAAGAATCTGAATCTGAAGCTGAAGAAGGTGACTGAATTTTGAAACTACACCCTCAGTAAAGCAAACAGGAGTTGTAGATAAAATGTCATGTCTCATGTGTCCTGGTTCTTACATCTTCCTACCTCCCTGTATCAAGCATGATATAAGGGCTTTCATGGCAAATTTTATTTTAACTGTTTCTATGGTTGCTGGAAATGTTGGGTTTAGTTTCTAAAACCATGTTTTAAGTAGCTACAGGAGCTATAGATTTGAATCTAATGTTGCATTAGTCTTTTCAGTTATCTTCTACCTCCTGTATTTTCTACTGTAATAATGTAATTTAAGGCCTTCCACAATGAACAGTTCACTTTATTCCCTGGGTTTTCTATAAACAGTTTTAAGGATATGATTTGGTTAAAAAATAATTTGTTATAAAAATTCTGTTTGCAAATTAAACTGGAAAAGTATCCAGAGTCTCAAAAGGCAATGATTTGTGAGATAATATGGCATGCCCGGAGCCCTGCTCATCAATGAAAAACCCATATGTAATAATCGAATTCATTTAACATGAATCTTGAGTACGTGGACCATTGCTTGCATGTTAACTTTTTGTTTTGTTTTGTTTTGTT