Transcript asmbl_27879

Sequence
Transcript Sequence for observation asmbl_27879 of TGE0001056:
GCCAACGGAAGTGGGTCGCAGGAAGAGGAAGTCCCGCCTCTCTCTCCTCAGGCAGCAGCAACGCGGAGGAAACGGGAGTGAACGGAGAGCGTAGTGACCATCATGAGCCTCCTCAACAAGCCCAAGAGTGAGATGACCCCAGAGGAGCTGCAGAAGCGAGAGGAGGAGGAATTTAACACCGGTCCACTCTCTGTGCTCACACAGTCAGTCAAGAACAATACCCAAGTGCTCATCAACTGCCGCAACAATAAGAAACTCCTGGGCCGCGTGAAGGCCTTCGATAGGCACTGCAACATGGTGCTGGAGAACGTGAAGGAGATGTGGACTGAGGTACCCAAGAGTGGCAAGGGCAAGAAGAAGTCCAAGCCAGTCAACAAAGACCGCTACATCTCCAAGATGTTCCTGCGCGGGGACTCAGTCATCGTGGTCCTGCGGAACCCGCTCATCGCCGGCAAGTAGGGGCCGCCTGTCTGTTGACAGAACTCACTCCTCTGTCCTATGAAGACCGCTGCCATTGGTGTTGAGAATAATAAAGCTCTGTGTTTTTTTCTAGTGGTA