Transcript asmbl_197075

Sequence
Transcript Sequence for observation asmbl_197075 of TGE0001202:
GGGCGGGTGAGGGGGCGGAGCCCGGGCGGGGCGGGGAGGGCTGCCGGAGGCTTGATTAGGTAGGAGGTGGCGAAGCGCCGGCGGCGGCCGGAAGTAGCCGAAGCCAGCGGCGGAAGTAGCCGAAGCGGCTGGAGCGGGCGGCAAGGCGAGGCGAAAGCTGCACAGGGCCCTACGCGGCCGCCTCAGCATGTCGGACTTCGACGAGTTCGAGCGGCAGCTCAACGAGAATAAACAAGAGCGGGACAAGGAGAACCGGCATCGGAAGCGCAGCCACAGCCGCTCTCGGAGCCGGGACCGCAAACGCCGGAGCCGGAGCCGCGACCGGCGCAACCGGGACCAGCGGAGCGCCTCCCGGGACAGGCGACGACGCAGCAAACCTTTGACCAGAGGCGCTAAAGAGGAGCACGGTGGACTGATTCGTTCCCCCCGCCACGAGAAGAAGAAGAAGGTCCGTAAATACTGGGACGTGCCACCCCCAGGCTTTGAGCACATCACCCCAATGCAGTACAAGGCCATGCAAGCTGCGGGTCAGATTCCAGCCACTGCTCTTCTCCCCACCATGACCCCTGACGGTCTGGCTGTGACCCCAACGCCGGTGCCCGTGGTCGGGAGCCAGATGACCAGACAAGCCCGGCGCCTCTACGTGGGCAACATCCCCTTTGGCATCACTGAGGAGGCCATGATGGATTTCTTCAACGCCCAGATGCGCCTGGGGGGGCTGACCCAGGCCCCTGGCAACCCAGTGTTGGCTGTGCAGATTAACCAGGACAAGAATTTTGCCTTTTTGGAGTTCCGCTCAGTGGACGAGACTACCCAGGCTATGGCCTTTGATGGCATCATCTTCCAGGGCCAGTCACTAAAGATCCGCAGGCCTCACGACTACCAGCCGCTTCCTGGCATGTCAGAGAACCCCTCCGTCTATGTGCCTGGGGTTGTGTCCACTGTGGTCCCCGACTCTGCCCACAAGCTGTTCATCGGGGGCTTACCCAACTACCTGAACGATGACCAGGTCAAAGAGCTGCTGACATCCTTTGGGCCCCTCAAGGCCTTCAACCTGGTCAAGGACAGTGCCACGGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACGGATCAGGCCATTGCGGGGCTGAACGGCATGCAGCTGGGGGATAAGAAGCTGCTGGTCCAGAGGGCGAGTGTGGGAGCCAAGAATGCCACGCTGGTGAGCCCCCCGAGCACCATCAATCAGACGCCTGTGACCCTGCAAGTGCCGGGCTTGATGAGCTCCCAGGTGCAGATGGGCGGCCACCCGACTGAGGTCCTGTGCCTCATGAACATGGTGCTGCCTGAGGAGCTGCTGGACGACGAGGAGTATGAGGAGATCGTGGAGGACGTGCGGGACGAGTGCAGCAAGTACGGGCTTGTCAAGTCCATCGAGATCCCCCGGCCTGTGGACGGCGTCGAGGTGCCCGGCTGCGGAAAGATCTTTGTGGAGTTCACCTCTGTGTTTGACTGCCAGAAAGCCATGCAGGGCCTGACGGGCCGCAAGTTCGCCAACAGAGTGGTTGTCACAAAATACTGTGACCCCGACTCTTATCACCGCCGGGACTTCTGGTAGAGGCGGCTGGGGGAGGGTGGGGGCAGGGCTGGCTGGGGGCTTCTCCCCACTCCCGCCCCCCCCTTATCCCCCTCTGAAGACGATGGGCAGAGGAGTGACAGCCGCAGACACACGACAGCCGGCAGCAACTGGAATGGCAGCAATTAAGGGTGGGGGGCGGGGGTTGGGGG