Transcript asmbl_194498

Sequence
Transcript Sequence for observation asmbl_194498 of TGE0001085:
AATTTTTGTATTTTTTTGTAGAGAGGCAGTCTCACTGTGTTGTCCTTACTAACTTTATATACAAAATTTTATCTGTTAAAGCCGGAATGGTTCTTTTCAGCGAGGCCCTGTCCCTGCTCCAGTATCTGTAATGAATTCTCGTGTTCCTCCCACAGTGGGACCTGAACCGCCAAACCGCACCTACGAGCAAACGGTAGGCGCTCCATAAATACTTGTTGATGTGGGTGCCATCGTGTAGATGACGGAGCACGAACCCGAGGCTCAGACAGGGGCGGCGACTTGTCCAAAGTCCCACTCCGTGGAGGAAGCGGCTCTGCAGACCTCAGGCGGCGGCTGCTCTAATCCCTGCAGCCTGTGTTTTGCCCTCCAGACGGCAGAGGGCGCGTGTTCGCCGCCGGGAAAGCGGAAGCGCGTGTGCGCGCACGGCCGAGGGGGCGGGACATGCCGGCAGTCTCGCGATAACTGCGCAGGCGCGGACCAAAGCGATCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCGCAAGTTCACCTACCGCGGCGTGGACCTCGACCAGCTGCTGGACATGTCCTACGAGCAGCTGATGCAGCTGTACAGTGCGCGCCAGCGGCGGCGGCTGAACCGGGGCCTGCGGCGGAAGCAGCACTCCCTGCTGAAGCGCCTGCGCAAGGCCAAGAAGGAGGCGCCGCCCATGGAGAAGCCGGAAGTGGTGAAGACGCACCTGCGGGACATGATCATCCTACCCGAGATGGTGGGCAGCATGGTGGGCGTCTACAACGGCAAGACCTTCAACCAGGTGGAGATCAAGCCCGAGATGATCGGCCACTACCTGGGCGAGTTCTCCATCACCTACAAGCCCGTAAAGCATGGCCGGCCCGGCATCGGGGCCACCCACTCCTCCCGCTTCATCCCTCTCAAGTAATGGCTCAGCTAATAAAGGCGCACATGACTCC