Transcript asmbl_192344

Sequence
Transcript Sequence for observation asmbl_192344 of TGE0001042:
GATCCGCGCTTCCGGCGCGCGCCGACGACGTCACGAGAAAAATCTTCCTGTTTATTGGATCTGCCTCCTGCGTGGTCCCACCCTCTCCAGCTCCCTCAGCCTATTCCCAGCCTCGACCGCATCCTTATCATGTTTCCCCGGATCCCATTGGCTTGCAGAAACACACTACAATTCCCGAGATGCTCTCCGTGACGCACTTACGCCTTCCGCCCCCTTGCATATTATTGTGGAGCTTCCCATTGGCTTACTTCGCCGCCGCTCGGAAAAAGTAAACTACATTTCCTAGCGTGCCCGTGTCTTGCTTCCGGCTGACGTGTCTTTCAGGAAGAGGAGCTGGTGAGAAGACAGCGAAATGGCGCCTCCGGCCCCCGGCCCGGCCTCCGGCGGCTCCGGGGAGGTAGACGAGCTGTTCGACGTAAAGAACGCCTTCTACATCGGCAGCTACCAGCAGTGCATAAACGAGGCGCAGCGGGTGAAGCTATCAAGCCCAGAGAGAGACGTGGAGAGGGACGTCTTCCTGTATAGAGCGTACCTGGCGCAGAGGAAGTTCGGTGTGGTCCTGGATGAGATCAAGCCCTCCTCGGCCCCTGAGCTCCAGGCCGTGCGCATGTTTGCTGACTACCTCGCCCACGAGAGTCGGAGGGACAGCATCGTGGCCGAGCTGGACCGAGAGATGAGCAGGAGCGTGGACGTGACCAACACCACCTTCCTGCTCATGGCCGCCTCCATCTATCTCCACGACCAGAACCCGGATGCCGCCCTGCGTGCGCTGCACCAGGGGGACAGCCTGGAGTGCACAGCCATGACAGTGCAGATCCTGCTGAAGCTGGACCGCCTGGACCTCGCCCGGAAGGAGCTGAAGAGAATGCAGGACCTGGACGAGGATGCCACCCTCACCCAGCTCGCCACTGCCTGGGTCAGCCTGGCCACGGGTGGTGAGAAGCTGCAGGATGCCTACTACATCTTCCAGGAGATGGCTGACAAGTGCTCGCCCACCCTGCTGCTGCTCAATGGGCAGGCGGCCTGCCACATGGCCCAGGGCCGCTGGGAGGCCGCTGAGGGCCTGCTGCAGGAGGCGCTAGACAAGGATAGTGGCTACCCAGAGACGCTGGTCAACCTCATCGTCCTGTCCCAGCACCTGGGCAAGCCCCCTGAGGTGACAAACCGATACCTGTCCCAGCTGAAGGATGCCCACAGGTCCCATCCCTTCATCAAGGAGTACCAGGCCAAGGAGAACGACTTTGACAGGCTGGTGCTACAGTACGCTCCCAGCGCCTGAGGCTGGCCCAGAGCTGTCAGGACCATGAAGCCAGGACAGAGGCCAGGAGCCAGCCCTGCAGCCCTCCCCACCCGGCATCCACCTGCATCCCCTCTGGGGGCAGGAGCCCACCCCCAGCACCCCCATCTGTTAATAAATATCTCAACTCCAGGGTGTTCCACCTG