Transcript asmbl_192013

Sequence
Transcript Sequence for observation asmbl_192013 of TGE0001028:
CTTTCCCCTATGAGACAGATCTTATCCCAACTCCGATCTTATCCCAACTCACCGCTCACCAAGGTCTGACACCTCCTACCCTCCCACACCCATGTCTCTGCCACACCTCACCGACCTCTTTCCATTTCTCCTTCAGGACTTTTCACCTTGGCATTTGCTATTCCCTCTTCCTTGGACATTCTTTCCCCAAATCTTTCCATATGGGACTTTCGCTTGTCGTTCTCGCTGCACTGGTCACGGGTCTTCTGCAATCGGACCCTCTCTGATTTCCCAAGCTTGCCCGCCCCCTTCTTTCTCTGTCTCTGCCCTTCCTGGCACCTATCCCCGAGTGACAGCTTCAGTGTCCTGCCCACACCCTCTCTTCCCCTGGGAGCTGCTTTAAAGCAGTATCTATTTCAATATATCCAAGAGTAAACCGAGCCTTAGAGAAAAGTAACCAGCCCAAGGGGACGCCTCCAGTGCGGAGCTGGGTGGAGATTTGCAGCCCGCCGAGGAAGGTCCCTTTGCAGCCAGCAGGAGAAGTAGGGCAACGGGGAGCCTTTGGGCATCGTCATCCCCGCCGCCTGAGGTTACCCTTTAGATGCTGCAGCCTCAGCTGCTCCCAGCTGTCACCTTCGCCCTGCTGCCCTAAGTACTGATAGTCCTGGTAGACCAGGGCAGGGGTCGCCAGCTGCAGGAGTAGCAGAGGCGCCAGCAGCAGCGCCCCCGGGGTCCGCGCCATGCTGGACTCCAACGGCCCCCAACGCGCTCCCAGGCGGAGTCGTGCGCGGAGTCTGCGGCGGGCGCATTACCCACGCGGGCAGGTGCAGTGGTCCCGGCCGAAGGCAACGCGTCTCCCCCCGCCGCCCGCAGGCGCATGGACCCGGCCGCACGCTCCCCCGCACCTGCGGGCGCAGTGGACCCGACCGCTCCGCTCGTCCGCTCCCTCCCCCGCGCCGTGCACGTCTTGGTTCGGGCCGGGCATAAAAGGCTTCGCGGCCCAGGGCTCACTTGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGCAGCTTTCAGTCATGGCCTCCGGTAACGCGCGCATCGGAAAGCCAGCCCCTGACTTCAAGGCCACAGCGGTGGTTGATGGCGCCTTCAAAGAGGTGAAGCTGTCGGACTACAAAGGGAAGTACGTGGTCCTCTTTTTCTACCCTCTGGACTTCACTTTTGTGTGCCCCACCGAGATCATCGCGTTCAGCAACCGTGCAGAGGACTTCCGCAAGCTGGGCTGTGAAGTGCTGGGCGTCTCGGTGGACTCTCAGTTCACCCACCTGGCTTGGATCAACACCCCCCGGAAAGAGGGAGGCTTGGGCCCCCTGAACATCCCCCTGCTTGCTGACGTGACCAGACGCTTGTCTGAGGATTACGGCGTGCTGAAAACAGATGAGGGCATTGCCTACAGGGGCCTCTTTATCATCGATGGCAAGGGTGTCCTTCGCCAGATCACTGTTAATGATTTGCCTGTGGGACGCTCCGTGGATGAGGCTCTGCGGCTGGTCCAGGCCTTCCAGTACACAGACGAGCATGGGGAAGTTTGTCCCGCTGGCTGGAAGCCTGGCAGTGACACGATTAAGCCCAACGTGGATGACAGCAAGGAATATTTCTCCAAACACAATTAGGCTGGCTAACGGATAGTGAGCTTGTGCCCCTGCCTAGGTGCCTGTGCTGGGTGTCCACCTGTGCCCCCACCTGGGTGCCCTATGCTGACCCAGGAAAGGCCAGACCTGCCCCTCCAAACTCCACAGTATGGGACCCTGGAGGGCTAGGCCAAGGCCTTCTCATGCCTCCACCTAGAAGCTGAATAGTGACGCCCTCCCCCAAGCCCACCCAGCCGCACACAGGCCTAGAGGTAACCAATAAAGTATTAGGGAAAGGTGTG