Transcript asmbl_190228

Sequence
Transcript Sequence for observation asmbl_190228 of TGE0000981:
GTTCCCCTTCCGAGCGTCCGCGCCCCGCATGCGCAGTCTGCCCCGGCGGTCTCCGTTTGTTTGAACAGGAAGGCGGACATATTAGTCCCTCTCAGCCCCCCTCGCCCCACCCCCCAGGCATTCGCCGCCGCGACTCGCCCTTTCCCCGGCTGGGACCGCAGCCCCTCCCAGAAGCTCCCCCATCAGCAGCCGCCGGGACCCAACTATCGTCTTCCTCTTCGCCCGCTCTCCAGCCTTTCCTCTGCTAAGTCTCCATCGGGCATCGACCTCGCCCTGCCCCACCGGACACCGTAGCAGCAGCCCCAGCAGCGACGGGACAAAATGGGAGAGTGAGGCTGTCCTGCGTGGACCAGCTCGTGGCCGAGACTGATCGGTGCGTCGGGCCGGGCCGAGTAGAGCCGGGGACGCGGGGCTAGACCGTCTACAGCGCCTCTGAGCGGAGCGGGCCCGGCCCGTGGCCCGAGCGGCGGCCGCAGCTGGCACAGCTCCTCACCCGCCCTTTGCTTTCGCCTTTCCTCTTCTCCCTCCCTTGTTGCCCGGAGGGAGTCTCCACCCTGCTTCTCTTTCTCTACCCGCTCCTGCCCATCTCGGGACGGGGACCCCTCCATGGCGACGGCGGCCGGGGCCCGCTAGACTGAAGCACCTCGCCGGAGCGACGAGGCTGGTGGCGACGGCGCTGTCGGCTGTCGTGAGGGGCTGCCGGGTGGGATGCGACTTTGGGCGTCCGAGCGGCTGTGGGTCGCTGTTGCCCCCGGCCCGGGGTCTGGAGAGCGGAGGTCCCCTCAGTGAGGGGAAGACGGGGGAACCGGGCGCACCTGGTGACCCTGAGGTTCCGGCTCCTCCGCCCCGCGGCTGCGAACCCACCGCGGAGGAAGTTGGTTGAAATTGCTTTCCGCTGCTGGTGCTGGTAAGAGGGCATTGTCACAGCAGCAGCAACATGTCGACTGGGGACAGTTTTGAGACTCGATTTGAAAAAATGGACAACCTGCTGCGGGATCCCAAATCGGAAGTGAATTCGGATTGTTTGCTGGATGGATTGGATGCTTTGGTATATGATTTGGATTTTCCTGCCTTAAGAAAAAACAAAAATATTGACAACTTTTTAAGCAGATATAAAGACACAATAAATAAAATCAGAGATTTACGAATGAAAGCTGAAGATTATGAAGTAGTGAAGGTGATTGGTAGAGGTGCATTTGGAGAAGTTCAATTGGTAAGGCATAAATCCACCAGGAAGGTATATGCTATGAAGCTTCTCAGCAAATTTGAAATGATAAAGAGATCTGATTCTGCTTTTTTCTGGGAAGAAAGGGACATCATGGCTTTTGCCAACAGTCCTTGGGTTGTTCAGCTTTTTTATGCATTCCAAGATGATCGTTATCTCTACATGGTGATGGAATACATGCCTGGTGGAGATCTTGTAAACTTAATGAGCAACTATGATGTGCCTGAAAAATGGGCACGATTCTATACTGCAGAAGTAGTTCTTGCATTGGATGCAATCCATTCCATGGGTTTTATTCACAGAGATGTGAAGCCTGATAACATGCTGCTGGATAAATCTGGACATTTGAAGTTAGCAGATTTTGGTACTTGTATGAAGATGAATAAGGAAGGCATGGTACGATGTGATACAGCGGTTGGAACACCTGATTATATTTCCCCTGAAGTATTAAAATCCCAAGGTGGTGATGGTTATTATGGAAGAGAATGTGACTGGTGGTCGGTTGGGGTATTTTTATACGAAATGCTTGTAGGTGATACACCTTTTTATGCAGATTCTTTGGTTGGAACTTACAGTAAAATTATGAACCATAAAAATTCACTTACCTTTCCTGATGATAATGACATATCAAAAGAAGCAAAAAACCTTATTTGTGCCTTCCTTACTGACAGGGAAGTGAGGTTAGGGCGAAATGGTGTAGAAGAAATCAAACGACATCTCTTCTTCAAAAATGACCAGTGGGCTTGGGAAACGCTCCGAGACACTGTAGCACCAGTTGTACCCGATTTAAGTAGTGACATTGATACTAGTAATTTTGATGACTTGGAAGAAGATAAAGGAGAGGAAGAAACATTCCCTATTCCTAAAGCTTTCGTTGGCAATCAACTACCTTTTGTAGGATTTACATATTATAGCAATCGTAGATACTTATCTTCAGCAAATCCTAATGATAACAGAACTAGCTCCAATGCAGATAAAAGCTTGCAGGAAAGTTTGCAAAAAACAATCTATAAGCTGGAAGAACAGCTGCATAATGAAATGCAGTTAAAAGATGAAATGGAGCAGAAGTGCAGAACCTCAAACATAAAACTAGACAAGATAATGAAAGAATTGGATGAAGAGGGAAATCAAAGAAGAAATCTAGAATCTACAGTGTCTCAGATTGAGAAGGAGAAAATGTTGCTACAGCATAGAATTAATGAGTACCAAAGAAAAGCTGAACAGGAAAATGAGAAGAGAAGAAATGTAGAAAATGAAGTTTCTACATTAAAGGATCAGTTGGAAGACTTAAAGAAAGTCAGTCAGAATTCACAGCTTGCTAATGAGAAGCTGTCCCAGTTACAAAAGCAGCTAGAAGAAGCCAATGACTTACTTAGGACAGAATCGGACACAGCTGTAAGATTGAGGAAGAGTCACACAGAGATGAGCAAGTCAATTAGTCAGTTAGAGTCCCTGAACAGAGAGTTGCAAGAGAGAAATCGAATTTTAGAGAATTCTAAGTCACAAACAGACAAAGATTATTACCAGCTGCAAGCTATATTAGAAGCTGAACGAAGAGACAGAGGTCATGATTCTGAGATGATTGGAGACCTTCAAGCTCGAATTACATCTTTACAAGAGGAGGTGAAGCATCTCAAACATAATCTCGAAAAAGTGGAAGGAGAAAGAAAAGAGGCTCAAGACATGCTTAATCACTCAGAAAAGGAAAAGAATAATTTAGAGATAGATTTAAACTACAAACTTAAATCATTACAACAACGGTTAGAACAAGAGGTAAATGAACACAAAGTAACCAAAGCTCGTTTAACTGACAAACATCAATCTATTGAAGAGGCAAAGTCTGTGGCAATGTGTGAGATGGAAAAAAAGCTGAAAGAAGAAAGAGAAGCTCGAGAGAAGGCTGAAAATCGGGTTGTTCAGATTGAGAAACAGTGTTCCATGCTAGACGTTGATCTGAAGCAATCTCAGCAGAAACTAGAACATTTGACTGGAAATAAAGAAAGGATGGAGGATGAAGTTAAGAATCTAACCCTGCAACTGGAGCAGGAATCAAATAAGCGGCTGTTGTTACAAAATGAATTGAAGACTCAAGCATTTGAGGCAGACAATTTAAAAGGTTTAGAAAAGCAGATGAAACAGGAAATAAATACTTTATTGGAAGCAAAGAGATTATTAGAATTTGAGTTAGCTCAGCTTACGAAACAGTATAGAGGAAATGAAGGACAGATGCGGGAGCTACAAGATCAGCTTGAAGCTGAGCAATATTTCTCGACACTTTATAAAACCCAGGTAAAGGAACTTAAAGAAGAAATTGAAGAAAAAAACAGAGAAAATTTAAAGAAAATACAGGAACTACAAAATGAAAAAGAAACTCTTGCTACTCAGTTGGATCTAGCAGAAACAAAAGCTGAGTCTGAGCAGTTGGCGCGAGGCCTTCTGGAAGAACAGTATTTTGAATTGACGCAAGAAAGCAAGAAAGCTGCTTCAAGAAATAGACAAGAGATTACAGATAAAGATCACACTGTTAGTCGGCTTGAAGAAGCAAACAGCATGCTAACCAAAGATATTGAAATATTAAGAAGAGAGAATGAAGAGCTAACAGAGAAAATGAAGAAGGCAGAGGAAGAATATAAACTGGAGAAGGAGGAGGAGATCAGTAATCTTAAGGCTGCCTTTGAAAAGAATATCAACACTGAACGAACCCTTAAAACACAGGCTGTTAACAAATTGGCAGAAATAATGAATCGAAAAGATTTTAAAATTGATAGAAAGAAAGCTAATACACAAGATTTGAGAAAGAAAGAAAAGGAAAATCGAAAGCTGCAACTGGAACTCAACCAAGAAAGAGAGAAATTCAACCAGATGGTAGTGAAACATCAGAAGGAACTGAATGACATGCAAGCGCAATTGGTAGAAGAATGTGCACATAGGAATGAGCTTCAGATGCAGTTGGCCAGCAAAGAGAGTGATATTGAGCAATTGCGTGCTAAACTTTTGGACCTCTCGGATTCTACAAGTGTTGCTAGTTTTCCTAGTGCTGATGAAACTGATGGTAACCTCCCAGAGTCAAGAATTGAAGGTTGGCTTTCAGTACCAAATAGAGGAAATATCAAACGATATGGCTGGAAGAAACAGTATGTTGTGGTAAGCAGCAAAAAAATTTTGTTCTATAATGACGAACAAGATAAGGAGCAATCCAATCCATCTATGGTATTGGACATAGATAAACTGTTTCACGTTAGACCTGTAACCCAAGGAGATGTGTATAGAGCTGAAACTGAAGAAATTCCTAAAATATTCCAGATACTATATGCAAATGAAGGTGAATGTAGAAAAGATGTAGAGATGGAACCAGTACAACAAGCTGAAAAAACTAATTTCCAAAATCACAAAGGCCATGAGTTTATTCCTACACTCTACCACTTTCCTGCCAATTGTGATGCCTGTGCCAAACCTCTCTGGCATGTTTTTAAGCCACCCCCTGCCCTAGAGTGTCGAAGATGCCATGTTAAGTGCCACAGAGATCACTTAGATAAGAAAGAGGACTTAATTTGTCCATGTAAAGTAAGTTATGATGTAACATCAGCAAGAGATATGCTGCTGTTAGCATGTTCTCAGGATGAACAAAAAAAATGGGTAACTCATTTAGTAAAGAAAATCCCTAAGAATCCACCATCTGGTTTTGTTCGTGCTTCCCCTCGAACGCTTTCTACAAGATCCACTGCAAATCAGTCTTTCCGGAAAGTGGTCAAAAATACATCTGGAAAAACTAGTTAACCATGTGACTGAGTGCCCTGTGGAATCGTGTGGGATGCTACCTGATAAACCAGGCTTCTTTAACCATGCAGAGCAGACAGGCTGTTTCTTTGACACAAATATCACAGGCTTCAGGGTTAAGATTGCTGTTTTTCTGTCCTTGCTTTGGCACAACACACTGAGGGTTTTTTTTATTGCGGGTTTGCCTACAGGTAGATTAGATTAATTATTACTATGTAATGCAAGTACAGTTGGGGGAAAGCTTAGGTAGATATATTTTTTTTAAAAGGTGCTGCCTTTTTGGATTTATAAGAAAATGCCTGTCAGTCGTGATAGAACAGAGTTTTCCTCATATGAGTAAGAGGAAGGGACTTTCACTTTCAAGTGGAACAGCCATCACTATCAAGATCAGCTCATGGAAGGAGTAAAGAAAATATCTCAAAATGAGACAAACTGAAGTTTTGTTTTTTTTTTAATGACTTAAGTTTTTGTGCTCTTGCAAGACTATACAAAACTATTTTAAGAAAGCAGTGATATCACTTGAACTTCAGTGCCCTCACTGTAGAATTTAAAAGCCTTACTGTTGATTGCCCATGTTGGACTTGATGGAGAAATTAAATATCTTTCATTATGCTTTACAAAATACTGTATATGTTTCAGCAAGTTTGGGGAATGGGAGAGGACAAAAAAAAGTTACATTTAATCTATGCATTTTTGCCAAGCCATATTGAGTTATTTTACTACTAGAGACATTAGGAAACTAACTGTACAAAAGAACCAAGTTTAAAAGCATTTTGTGGGGTACATCATTTCTATAATTGTATAATGTATTTCTTTGTGGTTTTAAATGATAAAGACATTAAGTTAACAAACATATAAGAAATGTATGCACTGTTTGAAATGTAAATTATTCTTAGAACACTTTCAATGGGGGTTGCATTGTCCTTTTAGTGCCTTAATTTGAGATAATTATTTTACTGCCATGAGTAAGTATAGAAATTTCAAAAAATGTATTTTCAAAAAATTATGTGTGTCAGTGAGTTTTTCATTGATAATTGGTTTAATTTAAAATATTTAGAGGTTTGTTGGACTTTCATAAATTGAGTACAATCTTTGCATCAAACTACCTGCTACAATAATGACTTTATAAAACTGCAAAAAATGTAGAAGGTTGCACCAACATAAAAAGGAAATATGGCAATACATCCATGATGTTTTCCAGTTAACATAGGAATTACCAGATAAATACTGTTAAACTCTTGTCCAGTAACAAGAGTTGATTCATATGGACAGTATGATTTATTGTTTATTTTTTTAACCAAATACCTCCTCAGTAATTTATAATGGCTTTGCAGTAATGTGTATCAGATAAGAAGCACTGGAAAACCGATCGTCTCTAGGATGATATGCATGTTTCAAGTGGTATTGAAAGCCGCACTGATGGATATGTAATAATAAACATATCTGTTATTAATATACTAATGACTCTGTGCTCATTTAATGAGAAATAAAAGTAATTTATGGATGGGTATCTTTAATTTTTACTGCAATGTGTTTTCTCATGGCTGAAATGAATGGAAAACATACTTCAAATTAGTCTCTGATTGTATATAAATGTTTGTGAAATTCCATGGTTAGATTAAAGTGTATTTTTAAAAGATAAAACGTGGTCTTGGGCTCTAAAACAAGAGTGGGAATAGTTCACATGAAAAGCTGGCTAAAGTGTGTTGGAAAACAATTCTCCATGGGTCTCTTGCATTTCTACACATCAGGGAAGCAGAGGCTCTGACAACCTTTCTTTTGACTATCTTTTCCAAGGATATTTATGTAGTAAACAGCCTTGGAAGATAGAGTTCTCCCTTGTGAGGATGTCGGGTTCTTTTACTGTCCAGTATAATAAAGATAACGTCTCCCACCTATGATGCAAACCCACTGTGTGCTCAGCACCCACCTGGGCCACTCTGCATTGCCCACATGGGGCTTGGAGGGCAAAGGGAACTGATGGAACGTGAAACTTATGCTGCTTTTGCTGTGCTGTGAATGAAGTCATCTGACTCTGACCCAGGGGTCTCATCTCTTTTGTCAGGATCCATGAAACTGTGACTGGCAGCATGCAAACAGGATAAAATCTCAGCACAGTTCCTGACGGTGTCCTTACTACCTTCTCAGACTCATCACCATTACCTAATATTTTAAGGTCCAGTTGCAGAGAACAGAGTTAATTCTAATTAGTTTAAGCAAGAGAAGACTTTCCAAATGACATACTAATCTGAACTTAGAATTGTTGAGAACTGAGAGAGCTTTGAGGAATCACTCCCAATGCCACATTACAGAACTGGGTCAACCAGGAGAGCTGCTTCCTCTTCTAAGTTCAGGAAACCACTCACTCCCAAGTATACCAATATTGAGAGGGTCCAGATAGTGCCATAATCAGGAATCCACACTACCACTGCTGGTTCTCTGCAACACTTGTCAGGCTTGCTACAATCTACCTCCAGTTAGATGTTTTGTACCATTCCTCTTGCCACTTAAGAACCTCATGTCTGCACACTGCCTCAGAAAAGGCACTTCCATGACCCTGCTTGCTGGCATTTAGCACAGCCTGCATCTCACGTCTGCCTTCTCTAGGTGCATCTACGTGGCCAAAATTAAATCACATCCAGACCCCTAGCTGCAAGAAAGTCTGAGAAATATAGCCTCTAGCTTTCTCTCTAATTTGTTACAGGAGGACACACTAGGAGTGTGGAATGAAGGTTCAGCATTGAGTTAGCCCATGCACCCACACCTGTAAGCTTCTCTGAGATCAGGAACTCCAGCTTTGGGCAACAAAGAAAACATAGCCACTGTCATTATTCACAGGTTCACTCATGACCTGTCATTTGGGGTTTCAGCTTAAATTAACCCATTCACCCTTCATTTAAAGTAAAAAAAATAAGTAAAAGAACTTAAATGACAAACTCATAGTTACTTGAGTTTGTAATTCATAGTTAACTTTCACAGTTCTATAATCAATCTGGAATTCAGAGTGAGGTAGAGATCAAGCAGTATTTCTCCCATATGGATATTCAGTTGATACTGCAGTATTCATTGAAAATACTTCTTTCCTGCATCGTAATTCAGGTGAACAATCCATTGGTGTTATTTCTGTGTCCTTGCCAATATCACACTTTTAATTACTGTAACTTTATAATAAGATTTTATATCTGTAGTAGAAGTCCAACTTTGTAATCCCTCCCAATTGGCTTGGCTATTCTTGGCCTTTTGCATTTCCATATAATTTTTTATTTTTGTTTTGAAACGAAGTTTCGCTCTTGTTGCCCAGGCTGGAGTGCAGTGGCGCGATCTCGGCTCACTG