Transcript asmbl_189639

Sequence
Transcript Sequence for observation asmbl_189639 of TGE0000969:
CGAGAGCTGGGAGAAGGCAGTGAGCGAGCAGGCGGCAGGCACGGTCCGTGCGGAGCAGGCGAGCGAGCGGGAAGACGCAGCCACCTTCCTCACCAGCCAGCCCACAGCGGTTTGTTCCCCTTCTCGGGAGTGCGCCAATGCCTGGGCCGACCCAAACCCTGTCCCCAAATGGCGAGAACAACAACGACATCATCCAGGATAATAACGGGACCATCATTCCTTTCCGGAAGCACACAGTGCGCGGGGAGCGTTCCTACAGTTGGGGAATGGCGGTCAATGTGTATTCTACCTCGATAACCCAAGAGACTATGAGCAGACATGACATCATTGCATGGGTTAATGACATAGTATCTTTAAACTACACAAAAGTGGAACAGCTTTGTTCAGGAGCGGCCTATTGCCAATTCATGGACATGCTCTTCCCTGGCTGCATTAGTTTGAAGAAAGTAAAATTTCAAGCAAAGCTGGAACATGAATATATTCACAATTTTAAACTTCTGCAAGCATCATTTAAGCGAATGAACGTTGATAAGGTAATTCCAGTGGAGAAGCTAGTGAAAGGACGTTTCCAGGACAACCTGGATTTTATTCAATGGTTTAAGAAATTCTATGATGCTAACTACGATGGGAAGGAGTATGATCCTGTAGAGGCACGACAAGGGCAAGATGCAATTCCTCCTCCTGACCCTGGTGAACAGATCTTCAACCTGCCAAAAAAGTCTCACCATGCAAACTCCCCCACAGCAGGTGCAGCTAAATCAAGTCCAGCAGCTAAACCAGGATCCACACCTTCTCGACCCTCATCAGCCAAAAGGGCTTCTTCCAGTGGCTCAGCATCCAAATCCGATAAAGATTTAGAAACGCAGGTCATACAGCTTAATGAACAGGTACATTCATTAAAACTTGCCCTTGAAGGCGTGGAAAAGGAAAGGGATTTCTACTTTGGGAAGTTGAGAGAGATCGAGCTACTCTGCCAAGAACACGGGCAGGAAAATGATGACCTCGTGCAGAGACTAATGGACATCCTGTATGCTTCAGAAGAACACGAGGGCCACACAGAAGAGCCGGAAGCAGAGGAGCAAGCCCACGAACAGCAGCCCCCGCAGCAGGAAGAGTACTGACCCACCCCGGCTGCTCTTGACACTTCCATTGTGTGTGGGAACGTTTCTTCTGGAGAATTGGAACATGTGTGGCCCCAAGCTCAACAGAAACCAGTTGTTCCCAATCTGCCGTTACCATCAACGCACTGTTGCATATGCCAGCCACTGCGCTTGGTTCCCATTTTCTTTGCCAAGGTGTATTAGCGGACGGCCCTCTGGCCACCTACCCGAGAGATCGTAGGGTCACATACATCCAACTTCACCACTTGGCTGCTTGAGATTGGTTCTGCTCTTTTCTTCATTTCTTTCCAGAACAACTCTTTCCCACCCCAACACCACTGCCACCACCCCTCTTTTTATCCTGGTGTGAAACAATGGTAATTTGATATATGGTATTTATATTGGCATTTTTCAACCCAGTGTCACTAGATGTCACACACATTTGTGGTGCTTTGATGTTTGCAAGTCTAACCTCTGAACATAAATTTGGTCAAATAATTGGAACAAAGGGAAACAGATACTTGATATGAAAGCCATAATGACGGTGACTTGTGTCGTGGGGGAAAACATAAGGTCATTTTCTCCCTCTACTCACAATACTAAAGGGAAAAAATGGATTCAAAGCTAGGATTTCAGGGCCCAGCAGTGTTCCTCCATCAGCATGTTAGACAACTACACAGTATGTTGTTAGTTTTGAAAGACATTCACTCAAGGAAAACACCATCTCAACTTTGCCCGCTCACCATGTCCCTTGCCCCCATGTAGCCCATTTCCCAGGTTATGCTCTTTTCTTTCTCAGGGTCCTCTTTGGTGGGCAGCCACTCCCCGAGATGTTGCCATCAGTTTTCTGCAGTCCAAAGAGGGTATGGTTAGGTACGGGTCTTCCTGCCTCATTCCTCTTCCTCTTTGTGTAGGTTTCAGCCACAAAACTGTCATTCACTCTAGGGGACCCCTACTAAAGGGTAACTTCAGGTGTGCAGCCCTGAGCTCCAAGGCTCTGCACCATGCCACACACTTGCTGTAAGGCTAGAAGTGAAGACCTTATTAATAGGAGCATAATTGCGAGGGAGAATCATGGTTCTGCAGTCTGGTGTAGACACTGGAATAACAGCACAGAAAAATCTATGACTCCCAATATCTTCTAGAATAAAGAATTTTCCCTCTTTAACACAAGGGCCCTCCTTGTCATTGACCTTAGCTAAACCATGGCAATTCATAAATAGAGGAAACATTAATGAATTAAAAGCATTCCTTATTTTTTAACTAATATTTGTACATTTTCTTAGTCTCTTTCCAAGTCTTTGCCTCTTTTTTTTCTTTATTTTTATTTTTTCCTTTGACAGATGGTATCCCTTCCTGGATCATTCATTTCACCTTGGTTTCTAACTTTAGGTTTACTTTCACTTGTTATTTGACTTAGCAGGTGCAACAAAAACAAGAAACAAATGTGCCCACCCCACTTTCCGCTTAACTGAAAAGCTTAAAATAAATTTCTGAATTATGTATCCTGAAGCTTTGAAATTTCTTTATTAATCGATGAAATATGAATTCTAAATTCTAGCATTGAAGCTTTTCACCAAAAGAAGTCTCTCCAAAATAAATCTTTTGCAGCAAAGTGATATTTATTGAGTTATGTGGAAAAGATGGCTTGTATTTTTCAGATTATTACAACACACTGTGCAGAATTAGACAGATGTTCCGTGGTGTTTGGTTTCCCTTTCTTCTCTCTCCTGCTCACTCTGCATTATAGCAGCAGCTTATTTCTCTAAGGCTGGACAGCCTGGCTCTCGGCAGTGACGTCCTCCCACACCTGGTCACAAGTAGTAGTGGCTGTGCTATACCCAGCATCATGCTTAACAGCGTGTTGCCCTTCTGAGCCTGTTGTACTCACTGATCTCTTTAAAAACAAAAAATAGCTCTTGTAAAAGGTCACAATAACTCTATGCACCTGATACTGCAGTGGTTCCTAGGCCATTCTTCATCTGCTCTGGACATCTCAGTCATACCCAATGCTCAGTGGATCATGACCAAACTCCTGTCATGTGGATGCACGTGAGTGGGTAGCAGGGAGTCAGGATCCTGCCTTCTCCAGCAACCCCTTACTGCTGTATAACTTGCATAAGCCTCCCTGGTGACTCTTGCAGGAACCACTCCATTGCCCTCCAGCTCCCCAGCCTTCTCAGTTATAAACATGCTGGCCAGATCTCTTAGCCTGCAAAGAGAACTTTCCCCAGTCACCATAGACCATTCTCCTTCCTGAAGGCTTGGGGCAGACCATTCGTTTATTTAGAGAAGAGCTATACATTCTTCTTTCTGGTCCCATCTTAAACGTCTTCTGTTGTGCTGCACCCCAGATGGTGTCTCAGATGCTTTGGGGAATCTTTAACAGCTGAATTTGAGTCAGTCCTCTTAGGCTGCACCTCCAGCCTCTGCAGATCCCCCCTCATTTCCCATGGATGGTGGGACCCCATTATTCTCTCATCTCGGCATTCAGGGAACAGTTTCCTTAGCGGCCCCTGGTCACATGTCATCGGGCTGGGCAGGAAGCGTCCCTGATTGCGTGCTCCACTTCTCCCTCTCAGGAAGCCCAGTTTCATCCTTAGTACCCCCCCTCGTGCCCGCTGTCGGCTGGTTATAGCACTTCCACTGCTACTGTCAGATAGGAAGTGATCGAAGCAGGGGGCAAAGAGAAAGCCCATATTTGTTCTAAGCAGAAAAGCAGG